Incidental Mutation 'R4214:Rin2'
ID319331
Institutional Source Beutler Lab
Gene Symbol Rin2
Ensembl Gene ENSMUSG00000001768
Gene NameRas and Rab interactor 2
SynonymsRASSF4, 4632403N06Rik, 2010003K16Rik
MMRRC Submission 041041-MU
Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145675215-145887616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145860446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 354 (T354I)
Ref Sequence ENSEMBL: ENSMUSP00000105632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]
Predicted Effect probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

DomainStartEndE-ValueType
SH2 50 136 1.38e-3 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
Blast:SH2 540 576 2e-7 BLAST
VPS9 612 730 1.72e-68 SMART
RA 751 842 3.35e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

DomainStartEndE-ValueType
SH2 95 181 1.38e-3 SMART
low complexity region 220 232 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
low complexity region 438 456 N/A INTRINSIC
Blast:SH2 585 621 2e-7 BLAST
VPS9 657 775 1.72e-68 SMART
RA 796 887 3.35e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145874
Predicted Effect probably benign
Transcript: ENSMUST00000147976
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Rin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Rin2 APN 2 145860006 splice site probably benign
IGL03222:Rin2 APN 2 145860195 nonsense probably null
IGL03371:Rin2 APN 2 145885926 utr 3 prime probably benign
IGL03411:Rin2 APN 2 145860944 missense probably damaging 0.99
D4043:Rin2 UTSW 2 145822363 missense possibly damaging 0.61
R0025:Rin2 UTSW 2 145878832 splice site probably benign
R0110:Rin2 UTSW 2 145861033 missense probably benign
R0144:Rin2 UTSW 2 145876639 missense probably damaging 0.96
R0510:Rin2 UTSW 2 145861033 missense probably benign
R1326:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1327:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1328:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1329:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1330:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1544:Rin2 UTSW 2 145858446 missense probably damaging 1.00
R1658:Rin2 UTSW 2 145876456 missense probably benign 0.04
R1832:Rin2 UTSW 2 145861171 missense possibly damaging 0.48
R1986:Rin2 UTSW 2 145878940 missense probably damaging 1.00
R2137:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2167:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2170:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2260:Rin2 UTSW 2 145878904 missense probably damaging 0.97
R2312:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2884:Rin2 UTSW 2 145860991 missense probably benign 0.07
R3155:Rin2 UTSW 2 145860851 missense probably benign 0.17
R3771:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3772:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3773:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3822:Rin2 UTSW 2 145822630 missense probably benign 0.02
R3824:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3825:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3885:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3893:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3939:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3940:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4012:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4019:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4058:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4231:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4232:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4236:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4372:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4410:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4415:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4471:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4490:Rin2 UTSW 2 145822274 missense possibly damaging 0.66
R4597:Rin2 UTSW 2 145860905 missense probably benign 0.01
R5099:Rin2 UTSW 2 145878901 missense probably damaging 1.00
R5268:Rin2 UTSW 2 145844760 missense probably benign
R5493:Rin2 UTSW 2 145860709 missense probably damaging 1.00
R5622:Rin2 UTSW 2 145860379 missense probably benign 0.07
R5947:Rin2 UTSW 2 145844943 intron probably benign
R6280:Rin2 UTSW 2 145861019 missense probably damaging 1.00
R7009:Rin2 UTSW 2 145883475 missense probably damaging 1.00
R7531:Rin2 UTSW 2 145858499 missense probably benign
R7824:Rin2 UTSW 2 145861117 missense probably benign 0.00
R8065:Rin2 UTSW 2 145861057 missense probably damaging 0.99
R8067:Rin2 UTSW 2 145861057 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAAGTGCACAGCCAGGAC -3'
(R):5'- AAAGGCTCATGTCGCTCAGC -3'

Sequencing Primer
(F):5'- AGGACTCCCAACGCGAATGG -3'
(R):5'- TGTGATTCAGAGCCGGGC -3'
Posted On2015-06-10