Incidental Mutation 'R4214:Catsperg1'
ID319342
Institutional Source Beutler Lab
Gene Symbol Catsperg1
Ensembl Gene ENSMUSG00000049676
Gene Namecation channel sperm associated auxiliary subunit gamma 1
SynonymsA230107C01Rik, Catsperg
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29181321-29214035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29195932 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 499 (R499G)
Ref Sequence ENSEMBL: ENSMUSP00000129837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047846] [ENSMUST00000069861] [ENSMUST00000163782] [ENSMUST00000164653] [ENSMUST00000169143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047846
AA Change: R499G

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045233
Gene: ENSMUSG00000049676
AA Change: R499G

DomainStartEndE-ValueType
Pfam:CATSPERG 1 920 N/A PFAM
transmembrane domain 1012 1034 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069861
SMART Domains Protein: ENSMUSP00000067388
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 57 7.9e-14 PFAM
Pfam:CATSPERG 73 205 7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163614
Predicted Effect probably benign
Transcript: ENSMUST00000163782
SMART Domains Protein: ENSMUSP00000127409
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 93 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164653
AA Change: R312G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131827
Gene: ENSMUSG00000049676
AA Change: R312G

DomainStartEndE-ValueType
Pfam:CATSPERG 1 111 1.4e-44 PFAM
Pfam:CATSPERG 108 334 8.5e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166654
Predicted Effect possibly damaging
Transcript: ENSMUST00000169143
AA Change: R499G

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129837
Gene: ENSMUSG00000049676
AA Change: R499G

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1111 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172226
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Catsperg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Catsperg1 APN 7 29198146 missense probably damaging 1.00
IGL01693:Catsperg1 APN 7 29185098 unclassified probably benign
IGL01935:Catsperg1 APN 7 29195871 splice site probably null
IGL02484:Catsperg1 APN 7 29210920 start gained probably benign
IGL02584:Catsperg1 APN 7 29184721 missense probably damaging 1.00
IGL02880:Catsperg1 APN 7 29195485 missense possibly damaging 0.75
IGL03268:Catsperg1 APN 7 29200243 missense probably damaging 1.00
IGL03285:Catsperg1 APN 7 29198172 missense possibly damaging 0.89
solid UTSW 7 29190298 nonsense probably null
K7894:Catsperg1 UTSW 7 29197154 intron probably benign
R0180:Catsperg1 UTSW 7 29190431 splice site probably null
R0344:Catsperg1 UTSW 7 29195540 missense probably damaging 1.00
R0523:Catsperg1 UTSW 7 29185190 unclassified probably benign
R0561:Catsperg1 UTSW 7 29182312 missense probably damaging 1.00
R0610:Catsperg1 UTSW 7 29190619 missense probably damaging 1.00
R0762:Catsperg1 UTSW 7 29189952 missense probably benign 0.03
R1074:Catsperg1 UTSW 7 29206849 missense probably damaging 1.00
R1201:Catsperg1 UTSW 7 29191670 missense possibly damaging 0.77
R1346:Catsperg1 UTSW 7 29182334 splice site probably null
R1387:Catsperg1 UTSW 7 29206864 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1486:Catsperg1 UTSW 7 29185495 missense probably damaging 1.00
R1883:Catsperg1 UTSW 7 29182236 critical splice donor site probably null
R1932:Catsperg1 UTSW 7 29198143 missense probably damaging 1.00
R1942:Catsperg1 UTSW 7 29206807 missense possibly damaging 0.89
R2127:Catsperg1 UTSW 7 29185040 missense probably damaging 1.00
R2205:Catsperg1 UTSW 7 29185246 nonsense probably null
R4678:Catsperg1 UTSW 7 29190296 missense probably benign 0.13
R5008:Catsperg1 UTSW 7 29195434 nonsense probably null
R5217:Catsperg1 UTSW 7 29190298 nonsense probably null
R5268:Catsperg1 UTSW 7 29195247 missense probably benign 0.41
R5372:Catsperg1 UTSW 7 29210712 missense probably benign 0.08
R5393:Catsperg1 UTSW 7 29185499 missense probably damaging 1.00
R5406:Catsperg1 UTSW 7 29185523 missense probably damaging 1.00
R5557:Catsperg1 UTSW 7 29195871 missense possibly damaging 0.89
R5921:Catsperg1 UTSW 7 29190523 missense possibly damaging 0.78
R5928:Catsperg1 UTSW 7 29206615 missense probably damaging 0.99
R5960:Catsperg1 UTSW 7 29184783 unclassified probably benign
R6053:Catsperg1 UTSW 7 29210814 nonsense probably null
R6144:Catsperg1 UTSW 7 29210695 missense probably damaging 0.99
R6215:Catsperg1 UTSW 7 29200239 missense probably damaging 1.00
R6334:Catsperg1 UTSW 7 29206357 missense probably benign 0.01
R6446:Catsperg1 UTSW 7 29206567 missense probably benign 0.00
R6854:Catsperg1 UTSW 7 29181702 missense possibly damaging 0.72
R7171:Catsperg1 UTSW 7 29185212 missense probably damaging 1.00
R7326:Catsperg1 UTSW 7 29210759 missense possibly damaging 0.82
R7382:Catsperg1 UTSW 7 29204844 missense probably benign 0.02
R7473:Catsperg1 UTSW 7 29195478 missense probably damaging 1.00
R7555:Catsperg1 UTSW 7 29189814 missense probably damaging 0.97
R7714:Catsperg1 UTSW 7 29185482 missense probably null 1.00
R7914:Catsperg1 UTSW 7 29195426 missense probably benign
R7935:Catsperg1 UTSW 7 29195919 missense possibly damaging 0.94
R8684:Catsperg1 UTSW 7 29198400 missense probably damaging 1.00
R8733:Catsperg1 UTSW 7 29191686 missense possibly damaging 0.95
Z1186:Catsperg1 UTSW 7 29181861 missense possibly damaging 0.85
Z1186:Catsperg1 UTSW 7 29181862 missense possibly damaging 0.85
Z1186:Catsperg1 UTSW 7 29181872 missense probably benign 0.00
Z1186:Catsperg1 UTSW 7 29182052 missense probably damaging 1.00
Z1186:Catsperg1 UTSW 7 29182122 missense probably benign 0.00
Z1186:Catsperg1 UTSW 7 29190250 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGACCCTGTTATAGGCAGC -3'
(R):5'- GAAGCTAGAGCCACAGTCAC -3'

Sequencing Primer
(F):5'- GGCAGCGCCTTCTACTGATC -3'
(R):5'- ACAGTCACAGGGTCACTTTG -3'
Posted On2015-06-10