Incidental Mutation 'R4214:Folr2'
ID319346
Institutional Source Beutler Lab
Gene Symbol Folr2
Ensembl Gene ENSMUSG00000032725
Gene Namefolate receptor 2 (fetal)
SynonymsFBP2, Folbp-2, FR-P3, Folbp2, Folbp2
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101839988-101857194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101843699 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 39 (K39T)
Ref Sequence ENSEMBL: ENSMUSP00000147283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094141] [ENSMUST00000209329] [ENSMUST00000210598] [ENSMUST00000211566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094141
AA Change: K39T

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091692
Gene: ENSMUSG00000032725
AA Change: K39T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Folate_rec 29 203 2.5e-64 PFAM
low complexity region 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209329
AA Change: K39T

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210598
AA Change: K39T

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211428
Predicted Effect probably damaging
Transcript: ENSMUST00000211566
AA Change: K39T

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211793
Meta Mutation Damage Score 0.1583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene encodes a receptor protein located on the plasma membrane that mediates folate uptake by cells. Mice lacking the product of this gene show no defects in embryonic development and grow normally into fertile adults. However, such mice were found to be highly susceptible to the teratogenic effects of arsenic. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and physically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Folr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Folr2 APN 7 101840386 missense probably damaging 0.98
Frontier UTSW 7 101840674 missense probably damaging 0.97
R4410:Folr2 UTSW 7 101840674 missense probably damaging 0.97
R4755:Folr2 UTSW 7 101843799 missense possibly damaging 0.86
R4944:Folr2 UTSW 7 101840290 unclassified probably null
R5421:Folr2 UTSW 7 101840644 missense probably benign 0.04
R7810:Folr2 UTSW 7 101840895 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACTGCTTCATTGCCACCAC -3'
(R):5'- GGGAATAAATGAAGTCCCTCCCC -3'

Sequencing Primer
(F):5'- ACTGTGTCCTCTTCTGGGGAC -3'
(R):5'- CCCTCTGGTCTAGGTCTCCCTAAC -3'
Posted On2015-06-10