Incidental Mutation 'R4214:Bco2'
ID319352
Institutional Source Beutler Lab
Gene Symbol Bco2
Ensembl Gene ENSMUSG00000032066
Gene Namebeta-carotene oxygenase 2
SynonymsCMO2, Bcdo2, beta-diox-II, B-diox-II, Bcmo2
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50533087-50555181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50545366 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 158 (M158T)
Ref Sequence ENSEMBL: ENSMUSP00000112727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119103]
Predicted Effect probably benign
Transcript: ENSMUST00000119103
AA Change: M158T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112727
Gene: ENSMUSG00000032066
AA Change: M158T

DomainStartEndE-ValueType
Pfam:RPE65 14 531 1.3e-116 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which oxidizes carotenoids such as beta-carotene during the biosynthesis of vitamin A. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased spleen weight, decreased testis and seminal vesicle weight, and increased tissue lycopene and beta-carotene levels when fed diets containing tomato powder or lycopene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Bco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Bco2 APN 9 50545858 splice site probably benign
IGL01967:Bco2 APN 9 50535509 missense probably damaging 0.97
IGL02793:Bco2 APN 9 50544534 missense probably damaging 1.00
R0523:Bco2 UTSW 9 50534626 missense probably damaging 1.00
R0928:Bco2 UTSW 9 50545931 missense probably damaging 1.00
R0972:Bco2 UTSW 9 50536315 missense probably benign 0.00
R1546:Bco2 UTSW 9 50550629 missense possibly damaging 0.52
R1795:Bco2 UTSW 9 50541169 missense possibly damaging 0.94
R1892:Bco2 UTSW 9 50550563 missense probably damaging 1.00
R1971:Bco2 UTSW 9 50545984 missense probably damaging 1.00
R2208:Bco2 UTSW 9 50533455 missense probably damaging 1.00
R3000:Bco2 UTSW 9 50538929 missense probably damaging 1.00
R5456:Bco2 UTSW 9 50545344 splice site probably null
R5458:Bco2 UTSW 9 50545344 splice site probably null
R8005:Bco2 UTSW 9 50538913 missense probably damaging 0.99
R8399:Bco2 UTSW 9 50541118 missense probably benign 0.25
R8680:Bco2 UTSW 9 50550578 missense probably damaging 1.00
R8880:Bco2 UTSW 9 50550662 missense probably damaging 1.00
RF015:Bco2 UTSW 9 50545997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGCATAGGGTGATAGTAAC -3'
(R):5'- GTAGCCCTTAACATGACAGGG -3'

Sequencing Primer
(F):5'- CCTAAATGAATGGATGCCTTTGTTC -3'
(R):5'- ATCCCACGGAGCTGGTATTACAG -3'
Posted On2015-06-10