Incidental Mutation 'R4214:Tbx18'
ID319355
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene NameT-box18
Synonyms2810404D13Rik, 2810012F10Rik
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87702800-87731260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87724465 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 209 (Y209C)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
Predicted Effect probably damaging
Transcript: ENSMUST00000034991
AA Change: Y209C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: Y209C

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192660
Meta Mutation Damage Score 0.9054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87705623 missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87705661 missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87724331 missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87713543 missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87724408 missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87707859 missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87727406 missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87730829 missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87705580 missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87729653 missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87715516 splice site probably benign
R0374:Tbx18 UTSW 9 87724355 missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87724409 missense probably benign 0.13
R2141:Tbx18 UTSW 9 87715653 missense probably damaging 0.99
R2183:Tbx18 UTSW 9 87705736 missense probably damaging 0.98
R2233:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2234:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87729636 missense probably benign
R4606:Tbx18 UTSW 9 87730769 missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87727449 missense possibly damaging 0.48
R5112:Tbx18 UTSW 9 87715687 missense probably damaging 1.00
R5887:Tbx18 UTSW 9 87713513 missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87715535 nonsense probably null
R6659:Tbx18 UTSW 9 87707811 missense probably damaging 1.00
R7001:Tbx18 UTSW 9 87727404 missense probably damaging 1.00
R7057:Tbx18 UTSW 9 87705264 missense possibly damaging 0.94
R7167:Tbx18 UTSW 9 87707830 missense probably damaging 1.00
R7368:Tbx18 UTSW 9 87730697 missense probably benign
R8147:Tbx18 UTSW 9 87724358 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAGCTAGGCACTGGGATGTG -3'
(R):5'- TCTGAATTATCCAAGGCCCCAG -3'

Sequencing Primer
(F):5'- CCAGAGAGGCTGTCTACTTACATG -3'
(R):5'- TTATCCAAGGCCCCAGAGTGC -3'
Posted On2015-06-10