Incidental Mutation 'R4214:AU041133'
ID319357
Institutional Source Beutler Lab
Gene Symbol AU041133
Ensembl Gene ENSMUSG00000078435
Gene Nameexpressed sequence AU041133
Synonyms
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4214 (G1)
Quality Score201
Status Validated
Chromosome10
Chromosomal Location82128013-82153065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82151389 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 292 (H292R)
Ref Sequence ENSEMBL: ENSMUSP00000144661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105314] [ENSMUST00000201286]
Predicted Effect probably damaging
Transcript: ENSMUST00000105314
AA Change: H291R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100951
Gene: ENSMUSG00000078435
AA Change: H291R

DomainStartEndE-ValueType
KRAB 3 65 1.77e-15 SMART
ZnF_C2H2 105 127 1.16e-1 SMART
ZnF_C2H2 133 155 3.26e-5 SMART
ZnF_C2H2 161 183 1.26e-2 SMART
ZnF_C2H2 189 211 7.37e-4 SMART
ZnF_C2H2 217 239 3.39e-3 SMART
ZnF_C2H2 245 267 1.26e-2 SMART
ZnF_C2H2 273 295 4.79e-3 SMART
ZnF_C2H2 301 323 6.99e-5 SMART
ZnF_C2H2 329 351 5.9e-3 SMART
ZnF_C2H2 357 379 1.03e-2 SMART
ZnF_C2H2 385 407 6.42e-4 SMART
ZnF_C2H2 413 435 8.94e-3 SMART
ZnF_C2H2 441 463 1.6e-4 SMART
ZnF_C2H2 469 491 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201286
AA Change: H292R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144661
Gene: ENSMUSG00000078435
AA Change: H292R

DomainStartEndE-ValueType
KRAB 4 66 7.7e-18 SMART
ZnF_C2H2 106 128 5e-4 SMART
ZnF_C2H2 134 156 1.4e-7 SMART
ZnF_C2H2 162 184 5.3e-5 SMART
ZnF_C2H2 190 212 3.2e-6 SMART
ZnF_C2H2 218 240 1.4e-5 SMART
ZnF_C2H2 246 268 5.3e-5 SMART
ZnF_C2H2 274 296 2e-5 SMART
ZnF_C2H2 302 324 3.1e-7 SMART
ZnF_C2H2 330 352 2.6e-5 SMART
ZnF_C2H2 358 380 4.5e-5 SMART
ZnF_C2H2 386 408 2.8e-6 SMART
ZnF_C2H2 414 436 3.9e-5 SMART
ZnF_C2H2 442 464 7e-7 SMART
ZnF_C2H2 470 492 2.5e-6 SMART
Meta Mutation Damage Score 0.7559 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in AU041133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03403:AU041133 APN 10 82138344 missense probably damaging 1.00
R0755:AU041133 UTSW 10 82150890 nonsense probably null
R1924:AU041133 UTSW 10 82151267 nonsense probably null
R2211:AU041133 UTSW 10 82150921 missense probably damaging 1.00
R2400:AU041133 UTSW 10 82150908 nonsense probably null
R3845:AU041133 UTSW 10 82151318 missense probably damaging 1.00
R3914:AU041133 UTSW 10 82151815 missense probably damaging 0.99
R4414:AU041133 UTSW 10 82151482 missense probably damaging 1.00
R5315:AU041133 UTSW 10 82151672 nonsense probably null
R5835:AU041133 UTSW 10 82151212 missense probably damaging 1.00
R6258:AU041133 UTSW 10 82151158 missense probably damaging 1.00
R6877:AU041133 UTSW 10 82151571 missense probably benign 0.24
R7127:AU041133 UTSW 10 82150866 missense probably benign 0.14
R7200:AU041133 UTSW 10 82151101 missense possibly damaging 0.94
R7228:AU041133 UTSW 10 82151271 missense possibly damaging 0.93
R7828:AU041133 UTSW 10 82151220 missense probably damaging 1.00
R8198:AU041133 UTSW 10 82151415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCTATGATTGCAACGAGTG -3'
(R):5'- ATGATAGGGTTTCTCTCCTGTATGAG -3'

Sequencing Primer
(F):5'- CCCTATGGATGTAACCAATGTGG -3'
(R):5'- AGGGTTTCTCTCCTGTATGAGTTCTC -3'
Posted On2015-06-10