Incidental Mutation 'R4214:Nab2'
ID319360
Institutional Source Beutler Lab
Gene Symbol Nab2
Ensembl Gene ENSMUSG00000025402
Gene NameNgfi-A binding protein 2
Synonyms
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127660918-127668568 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 127665048 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 25 (Y25*)
Ref Sequence ENSEMBL: ENSMUSP00000118036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157] [ENSMUST00000118728] [ENSMUST00000128780] [ENSMUST00000129252]
Predicted Effect probably null
Transcript: ENSMUST00000026469
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402
AA Change: Y58*

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092074
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099157
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402
AA Change: Y58*

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118728
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124388
Predicted Effect probably null
Transcript: ENSMUST00000128780
AA Change: Y25*
SMART Domains Protein: ENSMUSP00000121737
Gene: ENSMUSG00000025402
AA Change: Y25*

DomainStartEndE-ValueType
Pfam:NCD1 1 66 3.4e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129252
AA Change: Y25*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145470
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Nab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Nab2 APN 10 127665109 missense probably damaging 1.00
IGL01415:Nab2 APN 10 127665103 missense probably damaging 1.00
IGL02248:Nab2 APN 10 127663240 missense probably benign 0.31
IGL03080:Nab2 APN 10 127664794 missense possibly damaging 0.56
IGL03084:Nab2 APN 10 127664477 missense probably damaging 1.00
katie UTSW 10 127664338 missense probably damaging 1.00
R0381:Nab2 UTSW 10 127665067 missense probably damaging 1.00
R1074:Nab2 UTSW 10 127663255 nonsense probably null
R1535:Nab2 UTSW 10 127665047 missense probably damaging 0.99
R4742:Nab2 UTSW 10 127662827 missense probably benign 0.02
R5590:Nab2 UTSW 10 127664657 missense probably damaging 0.98
R5603:Nab2 UTSW 10 127665121 start codon destroyed probably null 0.96
R5776:Nab2 UTSW 10 127664329 missense probably damaging 0.99
R6018:Nab2 UTSW 10 127664924 nonsense probably null
R6381:Nab2 UTSW 10 127664351 missense probably damaging 1.00
R6610:Nab2 UTSW 10 127664338 missense probably damaging 1.00
R7025:Nab2 UTSW 10 127666508 intron probably benign
R8220:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8221:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8222:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8223:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8277:Nab2 UTSW 10 127665299 intron probably benign
R8293:Nab2 UTSW 10 127666397 missense possibly damaging 0.86
R8766:Nab2 UTSW 10 127666548 intron probably benign
RF005:Nab2 UTSW 10 127664364 missense probably benign 0.04
RF024:Nab2 UTSW 10 127664364 missense probably benign 0.04
Z1176:Nab2 UTSW 10 127663132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTTGAAAAGTGGGATGCTGG -3'
(R):5'- GATAGCTTAGGTCGGGCAAC -3'

Sequencing Primer
(F):5'- ATGCTGGAGACGGGCAC -3'
(R):5'- ATCGGAGGGCACTGTCCAG -3'
Posted On2015-06-10