Incidental Mutation 'R4214:Pfkp'
ID319364
Institutional Source Beutler Lab
Gene Symbol Pfkp
Ensembl Gene ENSMUSG00000021196
Gene Namephosphofructokinase, platelet
Synonyms9330125N24Rik, 1200015H23Rik, PFK-C
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location6579768-6648777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6619225 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 241 (S241P)
Ref Sequence ENSEMBL: ENSMUSP00000021614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021614] [ENSMUST00000136585] [ENSMUST00000138703]
Predicted Effect probably damaging
Transcript: ENSMUST00000021614
AA Change: S241P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021614
Gene: ENSMUSG00000021196
AA Change: S241P

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 25 332 4.7e-114 PFAM
Pfam:PFK 411 696 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135761
Predicted Effect probably benign
Transcript: ENSMUST00000136585
SMART Domains Protein: ENSMUSP00000115313
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
Pfam:PFK 1 167 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137327
Predicted Effect probably damaging
Transcript: ENSMUST00000138703
AA Change: S241P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117030
Gene: ENSMUSG00000021196
AA Change: S241P

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 24 334 6.7e-136 PFAM
Pfam:PFK 410 698 1.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151894
Meta Mutation Damage Score 0.2072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphofructokinase A protein family. The encoded enzyme is the platelet-specific isoform of phosphofructokinase and plays a key role in glycolysis regulation. This gene may play a role in metabolic reprogramming in some cancers, including clear cell renal cell carcinomas, and cancer of the bladder, breast, and lung. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Pfkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Pfkp APN 13 6619550 missense probably damaging 1.00
IGL00983:Pfkp APN 13 6581567 missense probably damaging 1.00
IGL01099:Pfkp APN 13 6603390 splice site probably benign
IGL01825:Pfkp APN 13 6620978 missense probably damaging 1.00
IGL02164:Pfkp APN 13 6597915 missense probably damaging 1.00
IGL02331:Pfkp APN 13 6597960 missense probably benign 0.33
IGL02680:Pfkp APN 13 6600672 unclassified probably benign
IGL02852:Pfkp APN 13 6605023 missense possibly damaging 0.57
R0414:Pfkp UTSW 13 6593210 missense probably benign 0.03
R0542:Pfkp UTSW 13 6621992 nonsense probably null
R0612:Pfkp UTSW 13 6605634 critical splice donor site probably null
R0767:Pfkp UTSW 13 6605012 missense probably damaging 0.98
R1417:Pfkp UTSW 13 6605719 missense probably benign 0.00
R1534:Pfkp UTSW 13 6619538 missense probably damaging 1.00
R1612:Pfkp UTSW 13 6588589 missense probably damaging 1.00
R2278:Pfkp UTSW 13 6619209 unclassified probably null
R2919:Pfkp UTSW 13 6593243 missense probably damaging 0.98
R2996:Pfkp UTSW 13 6635930 missense probably benign 0.01
R4374:Pfkp UTSW 13 6620989 missense probably damaging 1.00
R4693:Pfkp UTSW 13 6600635 missense possibly damaging 0.91
R5534:Pfkp UTSW 13 6648583 missense probably damaging 1.00
R5537:Pfkp UTSW 13 6619242 missense probably damaging 1.00
R5619:Pfkp UTSW 13 6598729 unclassified probably benign
R5677:Pfkp UTSW 13 6588595 missense probably damaging 1.00
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6216:Pfkp UTSW 13 6619188 missense probably benign 0.00
R6330:Pfkp UTSW 13 6585250 unclassified probably benign
R6676:Pfkp UTSW 13 6586539 missense possibly damaging 0.74
R7044:Pfkp UTSW 13 6581567 missense probably damaging 1.00
R7146:Pfkp UTSW 13 6602781 missense probably benign 0.00
R7193:Pfkp UTSW 13 6593216 missense probably benign 0.00
R7588:Pfkp UTSW 13 6648637 missense possibly damaging 0.81
R7611:Pfkp UTSW 13 6605083 critical splice acceptor site probably null
R7821:Pfkp UTSW 13 6597872 missense probably damaging 1.00
Z1177:Pfkp UTSW 13 6619252 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TGGCAGATCCTTGCCAACAG -3'
(R):5'- CCTGTGGGATATCAAGAGCTATAGC -3'

Sequencing Primer
(F):5'- AAGGCCTTGTGGATCCTT -3'
(R):5'- GCTATAGCTGTCAAAGGTTGTCTC -3'
Posted On2015-06-10