Incidental Mutation 'R4214:Vmn1r213'
ID319365
Institutional Source Beutler Lab
Gene Symbol Vmn1r213
Ensembl Gene ENSMUSG00000060024
Gene Namevomeronasal 1 receptor 213
SynonymsV1rh6
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23007656-23014482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23012003 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 252 (C252Y)
Ref Sequence ENSEMBL: ENSMUSP00000153766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076897] [ENSMUST00000227573] [ENSMUST00000228031] [ENSMUST00000228758]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076897
AA Change: C252Y

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076163
Gene: ENSMUSG00000060024
AA Change: C252Y

DomainStartEndE-ValueType
transmembrane domain 95 117 N/A INTRINSIC
Pfam:V1R 118 382 4.3e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227573
AA Change: C166Y

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228031
AA Change: C166Y

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228758
AA Change: C252Y

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Vmn1r213
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Vmn1r213 UTSW 13 23012141 missense probably damaging 1.00
R0094:Vmn1r213 UTSW 13 23011649 missense probably damaging 1.00
R0324:Vmn1r213 UTSW 13 23011418 intron probably benign
R0389:Vmn1r213 UTSW 13 23011762 missense probably benign 0.00
R0650:Vmn1r213 UTSW 13 23011394 intron probably benign
R0652:Vmn1r213 UTSW 13 23011394 intron probably benign
R1902:Vmn1r213 UTSW 13 23012306 missense possibly damaging 0.87
R1996:Vmn1r213 UTSW 13 23012303 missense probably benign 0.02
R1997:Vmn1r213 UTSW 13 23012303 missense probably benign 0.02
R4409:Vmn1r213 UTSW 13 23011423 intron probably benign
R4650:Vmn1r213 UTSW 13 23012252 missense possibly damaging 0.80
R4685:Vmn1r213 UTSW 13 23011630 missense probably benign 0.05
R4698:Vmn1r213 UTSW 13 23011337 intron probably benign
R4799:Vmn1r213 UTSW 13 23011846 missense probably damaging 1.00
R4807:Vmn1r213 UTSW 13 23011605 nonsense probably null
R5853:Vmn1r213 UTSW 13 23011514 missense probably benign 0.32
R7389:Vmn1r213 UTSW 13 23012386 missense probably benign 0.18
R7414:Vmn1r213 UTSW 13 23011276 missense unknown
R8054:Vmn1r213 UTSW 13 23011740 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCATCATCATCAGTCCCAGAG -3'
(R):5'- GCATCAGAAGGAGGACACTTTG -3'

Sequencing Primer
(F):5'- TCATCAGTCCCAGAGCATCTG -3'
(R):5'- AGGACACTTTGAGCAGCTCTC -3'
Posted On2015-06-10