Mutagenetix > Incidental Mutation

Incidental Mutation 'R4214:Adamts5'

319370

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

041041-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R4214 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 85868643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 590 (A590V)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: A590V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: A590V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Meta Mutation Damage Score

0.3890

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 95.5%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730013G03Rik	C	T	1: 192,833,537		noncoding transcript	Het
Abca12	T	A	1: 71,288,697	D1408V	probably damaging	Het
Abca13	A	T	11: 9,293,877	L1913F	probably damaging	Het
Acad9	A	G	3: 36,073,603	E118G	probably damaging	Het
Ano6	A	C	15: 95,965,909	Y791S	probably benign	Het
Aox2	T	C	1: 58,307,444		probably null	Het
Aox4	T	A	1: 58,221,892	I128N	probably damaging	Het
Atp2b3	A	G	X: 73,570,315	M1142V	probably benign	Het
AU041133	A	G	10: 82,151,389	H292R	probably damaging	Het
Bco2	A	G	9: 50,545,366	M158T	probably benign	Het
Bpnt1	T	A	1: 185,345,429		probably benign	Het
Cadm1	A	G	9: 47,797,443	D157G	probably damaging	Het
Catsperg1	T	C	7: 29,195,932	R499G	possibly damaging	Het
Ccr7	T	C	11: 99,145,046	E350G	probably damaging	Het
Ceacam5	T	A	7: 17,752,151	S524R	probably benign	Het
Cep78	T	C	19: 15,959,579	T588A	probably benign	Het
Cfap65	T	A	1: 74,927,681	E282D	possibly damaging	Het
Drd2	A	G	9: 49,404,921	K327R	probably benign	Het
Erich5	C	T	15: 34,471,411	P262L	possibly damaging	Het
Ezh2	A	C	6: 47,533,814	D578E	probably damaging	Het
Fez1	A	G	9: 36,870,488	N20S	probably damaging	Het
Folr2	T	G	7: 101,843,699	K39T	probably damaging	Het
Gm10549	G	T	18: 33,464,477		probably null	Het
Gm14393	C	T	2: 175,061,847	C89Y	probably benign	Het
Gm5329	T	G	7: 31,972,403		noncoding transcript	Het
Gm7367	A	G	7: 60,155,769		noncoding transcript	Het
Gpr162	A	T	6: 124,860,068	W338R	probably damaging	Het
Ift80	A	T	3: 68,990,808	F65I	possibly damaging	Het
Klra6	T	G	6: 130,018,922	I158L	probably benign	Het
Lpp	T	A	16: 24,762,054	Y173*	probably null	Het
Lrp12	A	G	15: 39,872,580	V671A	probably benign	Het
Lrrc27	C	T	7: 139,223,693	R178C	probably damaging	Het
Lrrc49	G	A	9: 60,666,326	T225M	probably benign	Het
Megf8	T	A	7: 25,355,368	S1915T	probably benign	Het
Mmadhc	T	C	2: 50,291,332	T109A	probably benign	Het
Mon2	T	C	10: 123,016,492	E992G	probably benign	Het
Msl3	A	T	X: 168,662,434	N430K	probably damaging	Het
Msl3	A	G	X: 168,667,063	I267T	probably damaging	Het
Nab2	G	T	10: 127,665,048	Y25*	probably null	Het
Notch3	T	C	17: 32,132,207	E1938G	possibly damaging	Het
Olfr291	C	T	7: 84,857,289	H307Y	probably benign	Het
Osgepl1	A	G	1: 53,315,008	T44A	probably damaging	Het
Pdpr	A	G	8: 111,129,580		probably benign	Het
Pfkp	A	G	13: 6,619,225	S241P	probably damaging	Het
Phgdh	A	T	3: 98,328,061	S166T	possibly damaging	Het
Plcl1	C	T	1: 55,751,335	Q1055*	probably null	Het
Plscr2	A	G	9: 92,287,737	N80S	probably benign	Het
Polr3k	A	T	2: 181,868,242	M80L	probably benign	Het
Prex2	A	G	1: 11,101,159	D304G	probably damaging	Het
Prex2	A	G	1: 11,285,061	T1529A	probably damaging	Het
Rcvrn	A	T	11: 67,695,688	H91L	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Tbx18	T	C	9: 87,724,465	Y209C	probably damaging	Het
Themis3	T	C	17: 66,560,017	N76S	probably benign	Het
Trhde	A	T	10: 114,788,070	S310T	possibly damaging	Het
Vmn1r213	G	A	13: 23,012,003	C252Y	possibly damaging	Het
Zfp523	T	C	17: 28,201,029	V216A	probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
R9616:Adamts5	UTSW	16	85862786	missense	probably benign	0.34
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTGCTCTAGCCAGTATG -3'
(R):5'- AATTGGTGCATATGTATCCACTGG -3'

Sequencing Primer
(F):5'- GCTCTAGCCAGTATGAGATTAATGC -3'
(R):5'- TCCACTGGGATGATATACGCAAGTG -3'

Posted On

2015-06-10