Incidental Mutation 'R4214:Adamts5'
ID319370
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms9530092O11Rik, ADAM-TS5
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location85856173-85901828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85868643 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 590 (A590V)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: A590V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: A590V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Meta Mutation Damage Score 0.3890 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85863004 missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8111:Adamts5 UTSW 16 85899315 missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85866618 critical splice donor site probably null
R8505:Adamts5 UTSW 16 85900056 missense probably benign 0.42
R8804:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGCTCTAGCCAGTATG -3'
(R):5'- AATTGGTGCATATGTATCCACTGG -3'

Sequencing Primer
(F):5'- GCTCTAGCCAGTATGAGATTAATGC -3'
(R):5'- TCCACTGGGATGATATACGCAAGTG -3'
Posted On2015-06-10