Incidental Mutation 'R4214:Atp2b3'
ID319375
Institutional Source Beutler Lab
Gene Symbol Atp2b3
Ensembl Gene ENSMUSG00000031376
Gene NameATPase, Ca++ transporting, plasma membrane 3
SynonymsPmca3, 6430519O13Rik
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4214 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location73503086-73571005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73570315 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1142 (M1142V)
Ref Sequence ENSEMBL: ENSMUSP00000085775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088429] [ENSMUST00000114479]
Predicted Effect probably benign
Transcript: ENSMUST00000088429
AA Change: M1142V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085775
Gene: ENSMUSG00000031376
AA Change: M1142V

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 158 310 1.8e-29 PFAM
Pfam:E1-E2_ATPase 348 462 3e-13 PFAM
Pfam:Hydrolase 467 806 1.3e-16 PFAM
Pfam:HAD 470 803 3.8e-21 PFAM
Pfam:Cation_ATPase 516 612 7.9e-18 PFAM
Pfam:Hydrolase_3 764 839 5.4e-7 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 1.5e-48 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1152 4.1e-27 PFAM
low complexity region 1174 1184 N/A INTRINSIC
low complexity region 1193 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114479
SMART Domains Protein: ENSMUSP00000110123
Gene: ENSMUSG00000031376

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 159 463 4.1e-58 PFAM
Pfam:Hydrolase 467 806 4.9e-27 PFAM
Pfam:HAD 470 803 4.7e-17 PFAM
Pfam:Hydrolase_like2 516 612 1.8e-17 PFAM
Pfam:Hydrolase_3 764 839 2.1e-6 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 2.3e-47 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1163 2.4e-15 PFAM
Meta Mutation Damage Score 0.7210 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 3. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Atp2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Atp2b3 APN X 73545360 splice site probably benign
IGL02640:Atp2b3 APN X 73542205 missense probably benign
R1518:Atp2b3 UTSW X 73545123 small deletion probably benign
R1571:Atp2b3 UTSW X 73545106 missense probably damaging 1.00
R2920:Atp2b3 UTSW X 73533920 missense probably benign 0.21
X0004:Atp2b3 UTSW X 73535494 missense probably damaging 0.99
Z1176:Atp2b3 UTSW X 73535424 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTGGGCACAACTTTCCAG -3'
(R):5'- GCTGAAGAGGTAGCTGACTTG -3'

Sequencing Primer
(F):5'- ACCAGCTAGCCATTGACTGTC -3'
(R):5'- AGCTGACTTGGTGGCATGC -3'
Posted On2015-06-10