Incidental Mutation 'R4222:Olfr617'
ID 319404
Institutional Source Beutler Lab
Gene Symbol Olfr617
Ensembl Gene ENSMUSG00000073946
Gene Name olfactory receptor 617
Synonyms GA_x6K02T2PBJ9-6306819-6307775, MOR31-10
MMRRC Submission 041042-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4222 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103573061-103586795 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103584759 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 246 (T246A)
Ref Sequence ENSEMBL: ENSMUSP00000149045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048265] [ENSMUST00000215755] [ENSMUST00000216516]
AlphaFold Q8VGA1
Predicted Effect probably damaging
Transcript: ENSMUST00000048265
AA Change: T246A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040319
Gene: ENSMUSG00000073946
AA Change: T246A

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 8.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 41 225 2.3e-10 PFAM
Pfam:7tm_1 47 299 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179692
Predicted Effect probably damaging
Transcript: ENSMUST00000215755
AA Change: T246A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216516
AA Change: T246A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,718,749 S1115T probably benign Het
Adgre4 A G 17: 55,785,121 Y127C probably damaging Het
AF366264 T C 8: 13,838,061 E10G probably benign Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Alkal1 A G 1: 6,388,615 K76R probably damaging Het
Atm T C 9: 53,480,669 S1807G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
Cyp3a11 A T 5: 145,860,466 Y368N probably damaging Het
Gar1 A T 3: 129,830,806 probably benign Het
Gm5265 A T 1: 169,453,801 noncoding transcript Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Hapln4 T A 8: 70,086,960 W214R probably damaging Het
Hist1h1b A T 13: 21,779,977 probably benign Het
Irgq C A 7: 24,533,625 A297D possibly damaging Het
Kri1 T C 9: 21,281,063 E145G probably benign Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mrpl22 T A 11: 58,171,867 probably benign Het
Myo7a T A 7: 98,073,229 Q1163L possibly damaging Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Nrxn3 G T 12: 89,532,992 G718* probably null Het
Olfm3 C T 3: 115,090,171 Q41* probably null Het
Olfr52 G T 2: 86,181,997 T38K probably damaging Het
Parm1 G A 5: 91,593,867 M31I probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Pkn2 A T 3: 142,793,866 L950* probably null Het
Plec C T 15: 76,177,319 R2671H probably damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptk7 A T 17: 46,574,463 M679K probably benign Het
Ptx3 C T 3: 66,224,706 T216I probably damaging Het
Rrp8 T C 7: 105,734,022 I346V possibly damaging Het
Rsrc1 A G 3: 66,994,567 K17E unknown Het
Ryr2 T A 13: 11,737,873 E1854V possibly damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Spag5 G A 11: 78,304,511 V215I probably damaging Het
Ston1 A G 17: 88,636,771 Y535C probably damaging Het
Tbc1d14 A T 5: 36,493,108 S395T probably benign Het
Tlr11 C T 14: 50,361,849 P431S probably damaging Het
Trerf1 G T 17: 47,314,801 noncoding transcript Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Ttc26 A G 6: 38,395,075 Y200C probably damaging Het
Vmn1r49 A G 6: 90,072,246 F258S probably benign Het
Vmn1r-ps103 C A 13: 22,442,028 noncoding transcript Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Zbtb5 A G 4: 44,993,855 probably null Het
Zfp35 T G 18: 24,003,189 F197V possibly damaging Het
Other mutations in Olfr617
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Olfr617 APN 7 103584693 missense probably damaging 1.00
IGL01355:Olfr617 APN 7 103584373 missense probably damaging 1.00
IGL01411:Olfr617 APN 7 103584117 missense probably damaging 1.00
IGL01412:Olfr617 APN 7 103584907 missense probably damaging 1.00
IGL02379:Olfr617 APN 7 103584892 missense possibly damaging 0.84
ANU23:Olfr617 UTSW 7 103584693 missense probably damaging 1.00
IGL03054:Olfr617 UTSW 7 103584840 missense probably benign 0.23
R0536:Olfr617 UTSW 7 103584261 missense probably damaging 1.00
R4224:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R5342:Olfr617 UTSW 7 103584828 missense probably benign 0.05
R5587:Olfr617 UTSW 7 103584531 missense probably benign 0.07
R5607:Olfr617 UTSW 7 103584299 nonsense probably null
R5608:Olfr617 UTSW 7 103584299 nonsense probably null
R6904:Olfr617 UTSW 7 103584520 missense possibly damaging 0.83
R6929:Olfr617 UTSW 7 103584444 missense probably damaging 0.98
R7399:Olfr617 UTSW 7 103584381 missense possibly damaging 0.78
R7607:Olfr617 UTSW 7 103584930 missense probably damaging 0.97
R7771:Olfr617 UTSW 7 103584090 missense probably benign 0.33
Z1177:Olfr617 UTSW 7 103584699 missense probably benign 0.41
Z1177:Olfr617 UTSW 7 103584947 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTGAACACATGGGCATTG -3'
(R):5'- TTGCCCAAAGAAAAGACTTGG -3'

Sequencing Primer
(F):5'- CTAGATGCAGTGCTGATC -3'
(R):5'- AAGACTTGGATAACCCTCTCCTG -3'
Posted On 2015-06-10