Incidental Mutation 'R4222:AF366264'
ID 319406
Institutional Source Beutler Lab
Gene Symbol AF366264
Ensembl Gene ENSMUSG00000057116
Gene Name cDNA sequence AF366264
Synonyms
MMRRC Submission 041042-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock # R4222 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 13835233-13838389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13838061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 10 (E10G)
Ref Sequence ENSEMBL: ENSMUSP00000096518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071308]
AlphaFold G3X9P9
Predicted Effect probably benign
Transcript: ENSMUST00000071308
AA Change: E10G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096518
Gene: ENSMUSG00000057116
AA Change: E10G

DomainStartEndE-ValueType
Pfam:Peptidase_C48 322 501 1.9e-45 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 91% (49/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,718,749 S1115T probably benign Het
Adgre4 A G 17: 55,785,121 Y127C probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Alkal1 A G 1: 6,388,615 K76R probably damaging Het
Atm T C 9: 53,480,669 S1807G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
Cyp3a11 A T 5: 145,860,466 Y368N probably damaging Het
Gar1 A T 3: 129,830,806 probably benign Het
Gm5265 A T 1: 169,453,801 noncoding transcript Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Hapln4 T A 8: 70,086,960 W214R probably damaging Het
Hist1h1b A T 13: 21,779,977 probably benign Het
Irgq C A 7: 24,533,625 A297D possibly damaging Het
Kri1 T C 9: 21,281,063 E145G probably benign Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mrpl22 T A 11: 58,171,867 probably benign Het
Myo7a T A 7: 98,073,229 Q1163L possibly damaging Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Nrxn3 G T 12: 89,532,992 G718* probably null Het
Olfm3 C T 3: 115,090,171 Q41* probably null Het
Olfr52 G T 2: 86,181,997 T38K probably damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Parm1 G A 5: 91,593,867 M31I probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Pkn2 A T 3: 142,793,866 L950* probably null Het
Plec C T 15: 76,177,319 R2671H probably damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptk7 A T 17: 46,574,463 M679K probably benign Het
Ptx3 C T 3: 66,224,706 T216I probably damaging Het
Rrp8 T C 7: 105,734,022 I346V possibly damaging Het
Rsrc1 A G 3: 66,994,567 K17E unknown Het
Ryr2 T A 13: 11,737,873 E1854V possibly damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Spag5 G A 11: 78,304,511 V215I probably damaging Het
Ston1 A G 17: 88,636,771 Y535C probably damaging Het
Tbc1d14 A T 5: 36,493,108 S395T probably benign Het
Tlr11 C T 14: 50,361,849 P431S probably damaging Het
Trerf1 G T 17: 47,314,801 noncoding transcript Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Ttc26 A G 6: 38,395,075 Y200C probably damaging Het
Vmn1r49 A G 6: 90,072,246 F258S probably benign Het
Vmn1r-ps103 C A 13: 22,442,028 noncoding transcript Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Zbtb5 A G 4: 44,993,855 probably null Het
Zfp35 T G 18: 24,003,189 F197V possibly damaging Het
Other mutations in AF366264
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02291:AF366264 APN 8 13837704 missense probably benign 0.03
IGL02647:AF366264 APN 8 13836979 missense probably damaging 0.96
IGL03118:AF366264 APN 8 13838096 utr 5 prime probably benign
FR4342:AF366264 UTSW 8 13837613 missense probably benign 0.00
R0636:AF366264 UTSW 8 13837870 missense probably benign 0.00
R1796:AF366264 UTSW 8 13836816 nonsense probably null
R1913:AF366264 UTSW 8 13837143 missense probably benign 0.16
R2353:AF366264 UTSW 8 13836951 missense probably damaging 1.00
R2944:AF366264 UTSW 8 13837212 missense probably damaging 1.00
R3714:AF366264 UTSW 8 13836736 missense probably benign 0.04
R4628:AF366264 UTSW 8 13836625 missense probably damaging 1.00
R4801:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4802:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4836:AF366264 UTSW 8 13838007 missense probably benign
R5143:AF366264 UTSW 8 13836844 missense possibly damaging 0.87
R5637:AF366264 UTSW 8 13837713 missense possibly damaging 0.46
R5930:AF366264 UTSW 8 13837263 missense probably benign 0.06
R6540:AF366264 UTSW 8 13837573 missense probably benign 0.07
R6556:AF366264 UTSW 8 13837690 nonsense probably null
R6724:AF366264 UTSW 8 13837083 missense probably damaging 1.00
R7131:AF366264 UTSW 8 13836982 missense probably damaging 0.98
R7148:AF366264 UTSW 8 13837996 missense probably benign 0.01
R7660:AF366264 UTSW 8 13837995 missense probably benign 0.06
R8198:AF366264 UTSW 8 13837056 missense probably benign 0.11
R8483:AF366264 UTSW 8 13838229 start gained probably benign
R9090:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
R9271:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
X0020:AF366264 UTSW 8 13836847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCTCTCGGGAGCTCTAG -3'
(R):5'- TTTGCGACCTTGGACCAACC -3'

Sequencing Primer
(F):5'- AGCTCTAGGTCTTGAGGCTCC -3'
(R):5'- GCCAGGTATAAGGTTGCT -3'
Posted On 2015-06-10