Incidental Mutation 'R0395:Dchs1'
ID 31942
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms C130033F22Rik, 3110041P15Rik
MMRRC Submission 038601-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0395 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105402197-105436861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105407745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 2029 (L2029P)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: L2029P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: L2029P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131504
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Meta Mutation Damage Score 0.8643 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,837,470 (GRCm39) K205R possibly damaging Het
9630041A04Rik A T 9: 101,819,934 (GRCm39) N118I probably damaging Het
AAdacl4fm3 A G 4: 144,429,765 (GRCm39) V408A probably benign Het
Acsm2 G A 7: 119,174,969 (GRCm39) D245N probably damaging Het
Adgrv1 A T 13: 81,534,072 (GRCm39) H5836Q probably benign Het
Ahcyl2 T C 6: 29,886,167 (GRCm39) V391A probably damaging Het
Alcam A T 16: 52,130,227 (GRCm39) M41K probably benign Het
Aldh3b3 A C 19: 4,016,472 (GRCm39) E363D probably benign Het
Alk A G 17: 72,910,526 (GRCm39) V60A probably damaging Het
Als2cl G A 9: 110,727,152 (GRCm39) R906H probably damaging Het
Ap5z1 T C 5: 142,456,317 (GRCm39) probably benign Het
Apba2 T A 7: 64,393,156 (GRCm39) I547N probably benign Het
Apol10b A T 15: 77,469,840 (GRCm39) D112E probably damaging Het
Ash1l C A 3: 88,965,896 (GRCm39) R2433S probably damaging Het
Cachd1 T C 4: 100,810,402 (GRCm39) F335L probably damaging Het
Cbfa2t3 G T 8: 123,365,690 (GRCm39) Q181K probably benign Het
Cct6b A G 11: 82,630,506 (GRCm39) M265T probably benign Het
Cd151 G A 7: 141,050,304 (GRCm39) V180I probably damaging Het
Ces1h T A 8: 94,083,706 (GRCm39) N412I unknown Het
Chmp7 T C 14: 69,969,905 (GRCm39) T12A probably benign Het
Clasp1 A G 1: 118,467,061 (GRCm39) T534A possibly damaging Het
Cldn15 T A 5: 136,997,052 (GRCm39) V31E possibly damaging Het
Col16a1 G A 4: 129,966,902 (GRCm39) G583D probably damaging Het
Csmd1 T C 8: 16,396,652 (GRCm39) N426S probably damaging Het
Dapp1 C T 3: 137,641,398 (GRCm39) C199Y possibly damaging Het
Dmc1 A G 15: 79,472,973 (GRCm39) F158S probably damaging Het
Dst C T 1: 34,228,200 (GRCm39) P1606L probably damaging Het
Dthd1 T A 5: 62,971,676 (GRCm39) N166K possibly damaging Het
Enam A T 5: 88,649,367 (GRCm39) Y292F probably damaging Het
Esrrg A T 1: 187,930,832 (GRCm39) I285F probably damaging Het
Fam50b A G 13: 34,931,220 (GRCm39) D232G probably damaging Het
Fam91a1 T A 15: 58,326,641 (GRCm39) S792T probably benign Het
Fbxw22 A C 9: 109,210,753 (GRCm39) C419W probably damaging Het
Flt4 G A 11: 49,521,170 (GRCm39) S393N probably benign Het
Fras1 A T 5: 96,917,512 (GRCm39) T3511S possibly damaging Het
Frat2 A C 19: 41,836,263 (GRCm39) S30A probably damaging Het
Glp1r T A 17: 31,155,312 (GRCm39) M433K probably benign Het
Gm10300 G A 4: 131,802,299 (GRCm39) probably benign Het
Gpatch4 A G 3: 87,961,661 (GRCm39) probably benign Het
Gpr22 A T 12: 31,759,461 (GRCm39) S220R possibly damaging Het
Grn T C 11: 102,327,049 (GRCm39) V549A probably benign Het
Gtf3c5 T C 2: 28,467,930 (GRCm39) D177G probably damaging Het
Htr1b A T 9: 81,513,704 (GRCm39) M301K probably benign Het
Ifi207 A T 1: 173,557,431 (GRCm39) S436T possibly damaging Het
Ifnb1 A T 4: 88,440,766 (GRCm39) N82K possibly damaging Het
Ina T G 19: 47,010,358 (GRCm39) N384K probably damaging Het
Kirrel2 T C 7: 30,149,883 (GRCm39) N541D possibly damaging Het
Lrp2 A T 2: 69,263,421 (GRCm39) I4377N possibly damaging Het
Lrrc37a A G 11: 103,355,221 (GRCm39) V2532A unknown Het
Mast4 T C 13: 102,871,781 (GRCm39) E2529G probably damaging Het
Myh6 T C 14: 55,183,777 (GRCm39) H1719R possibly damaging Het
Myo5a A T 9: 75,101,259 (GRCm39) H150L probably benign Het
Naglu C T 11: 100,964,933 (GRCm39) probably benign Het
Nags G A 11: 102,036,530 (GRCm39) A40T unknown Het
Nav1 G T 1: 135,460,359 (GRCm39) Y321* probably null Het
Nav1 A T 1: 135,460,361 (GRCm39) Y321N probably damaging Het
Neu3 C T 7: 99,462,985 (GRCm39) S246N probably benign Het
Npy5r C T 8: 67,134,625 (GRCm39) G56D probably benign Het
Nrxn1 A G 17: 91,395,742 (GRCm39) V138A possibly damaging Het
Nuggc C T 14: 65,850,921 (GRCm39) Q264* probably null Het
Ogfod1 G A 8: 94,790,156 (GRCm39) probably null Het
Or1o11 T A 17: 37,756,757 (GRCm39) F115Y probably damaging Het
Or2t45 A T 11: 58,669,195 (GRCm39) M81L probably benign Het
Or5b101 A G 19: 13,005,663 (GRCm39) F10S probably damaging Het
Or5p66 A G 7: 107,885,478 (GRCm39) V285A probably benign Het
Per1 T A 11: 68,993,103 (GRCm39) I340N probably damaging Het
Pkhd1 C T 1: 20,451,771 (GRCm39) A2175T probably benign Het
Pogk A G 1: 166,231,171 (GRCm39) V52A probably damaging Het
Pou2af3 C T 9: 51,191,834 (GRCm39) probably benign Het
Ppib A T 9: 65,973,601 (GRCm39) T185S possibly damaging Het
Ptar1 G T 19: 23,697,563 (GRCm39) M358I probably damaging Het
Qser1 A C 2: 104,593,226 (GRCm39) I1597S probably damaging Het
Ranbp17 T C 11: 33,424,896 (GRCm39) I487V probably benign Het
Repin1 C A 6: 48,574,459 (GRCm39) R460S probably damaging Het
Sfmbt1 T C 14: 30,509,574 (GRCm39) probably benign Het
Sh3rf1 C T 8: 61,846,696 (GRCm39) probably benign Het
Shroom3 C T 5: 92,928,762 (GRCm39) R106C probably damaging Het
Siglecf T A 7: 43,005,399 (GRCm39) V453D probably damaging Het
Slc2a9 A G 5: 38,610,512 (GRCm39) S96P probably damaging Het
Slc5a2 A G 7: 127,866,654 (GRCm39) Y124C probably damaging Het
Slf1 A G 13: 77,254,088 (GRCm39) probably benign Het
Smad1 T G 8: 80,076,411 (GRCm39) K269T probably benign Het
Srp54b G A 12: 55,296,884 (GRCm39) R194H probably damaging Het
St8sia6 T A 2: 13,670,247 (GRCm39) S238C probably damaging Het
Stat3 A T 11: 100,780,763 (GRCm39) probably benign Het
Tafa2 A T 10: 123,429,497 (GRCm39) H37L probably benign Het
Tas1r2 T A 4: 139,382,665 (GRCm39) M101K possibly damaging Het
Tesc A G 5: 118,191,647 (GRCm39) probably null Het
Tle3 T A 9: 61,317,353 (GRCm39) M334K probably damaging Het
Tmem151a A T 19: 5,132,261 (GRCm39) V315E probably damaging Het
Tmprss2 T C 16: 97,368,245 (GRCm39) D480G probably damaging Het
Trmt1 C A 8: 85,423,741 (GRCm39) probably null Het
Tsr3 T C 17: 25,461,198 (GRCm39) probably null Het
Ube2u A G 4: 100,338,845 (GRCm39) K37E probably benign Het
Usp16 T A 16: 87,272,334 (GRCm39) D382E probably damaging Het
Usp9y A T Y: 1,340,053 (GRCm39) F1442Y probably damaging Het
Utp20 A T 10: 88,654,457 (GRCm39) M210K probably damaging Het
Utp25 T C 1: 192,805,984 (GRCm39) E187G possibly damaging Het
V1ra8 C T 6: 90,179,991 (GRCm39) L65F possibly damaging Het
Vmn2r10 T C 5: 109,149,859 (GRCm39) N395S probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp330 G A 8: 83,491,511 (GRCm39) Q221* probably null Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105,407,950 (GRCm39) missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105,407,236 (GRCm39) missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105,407,631 (GRCm39) missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105,404,468 (GRCm39) missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105,407,414 (GRCm39) missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105,407,150 (GRCm39) missense probably benign
IGL01292:Dchs1 APN 7 105,410,098 (GRCm39) missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105,411,418 (GRCm39) missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105,421,490 (GRCm39) missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105,421,134 (GRCm39) missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105,404,509 (GRCm39) missense probably benign 0.00
IGL01829:Dchs1 APN 7 105,404,604 (GRCm39) missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105,408,312 (GRCm39) missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105,406,798 (GRCm39) missense probably benign 0.00
IGL02012:Dchs1 APN 7 105,413,504 (GRCm39) missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105,414,094 (GRCm39) missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105,421,776 (GRCm39) missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105,404,395 (GRCm39) missense probably benign 0.22
IGL02430:Dchs1 APN 7 105,421,178 (GRCm39) missense probably benign 0.34
IGL02500:Dchs1 APN 7 105,405,013 (GRCm39) missense probably benign
IGL02741:Dchs1 APN 7 105,406,530 (GRCm39) missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105,405,698 (GRCm39) missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105,404,279 (GRCm39) missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105,407,612 (GRCm39) missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105,406,795 (GRCm39) missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105,408,178 (GRCm39) missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105,405,043 (GRCm39) missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105,405,139 (GRCm39) missense probably benign 0.18
R0091:Dchs1 UTSW 7 105,415,301 (GRCm39) splice site probably benign
R0193:Dchs1 UTSW 7 105,414,190 (GRCm39) missense probably benign 0.40
R0448:Dchs1 UTSW 7 105,415,134 (GRCm39) missense probably benign 0.00
R0480:Dchs1 UTSW 7 105,420,696 (GRCm39) missense probably benign 0.14
R0485:Dchs1 UTSW 7 105,421,934 (GRCm39) missense probably benign 0.00
R0566:Dchs1 UTSW 7 105,408,402 (GRCm39) missense probably benign 0.00
R0571:Dchs1 UTSW 7 105,421,203 (GRCm39) missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105,407,985 (GRCm39) missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105,413,462 (GRCm39) missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105,412,656 (GRCm39) missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105,421,556 (GRCm39) missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105,414,191 (GRCm39) missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105,406,921 (GRCm39) missense probably benign
R1241:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105,404,778 (GRCm39) missense probably benign 0.40
R1427:Dchs1 UTSW 7 105,415,398 (GRCm39) missense probably benign 0.06
R1458:Dchs1 UTSW 7 105,404,451 (GRCm39) missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105,421,278 (GRCm39) nonsense probably null
R1524:Dchs1 UTSW 7 105,413,732 (GRCm39) missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105,408,138 (GRCm39) missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105,421,247 (GRCm39) missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105,421,068 (GRCm39) missense probably benign 0.01
R1577:Dchs1 UTSW 7 105,415,162 (GRCm39) missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105,411,977 (GRCm39) missense probably benign 0.24
R1676:Dchs1 UTSW 7 105,404,128 (GRCm39) missense probably benign 0.40
R1794:Dchs1 UTSW 7 105,420,927 (GRCm39) missense probably benign 0.02
R1826:Dchs1 UTSW 7 105,406,834 (GRCm39) missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105,413,363 (GRCm39) missense probably benign 0.00
R1924:Dchs1 UTSW 7 105,421,487 (GRCm39) missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105,415,109 (GRCm39) missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105,413,408 (GRCm39) missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105,421,605 (GRCm39) missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105,411,755 (GRCm39) missense probably benign 0.00
R2007:Dchs1 UTSW 7 105,404,532 (GRCm39) missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105,413,411 (GRCm39) missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105,403,301 (GRCm39) missense probably benign
R2474:Dchs1 UTSW 7 105,422,045 (GRCm39) missense probably damaging 1.00
R2474:Dchs1 UTSW 7 105,404,281 (GRCm39) missense probably benign 0.37
R3429:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105,411,523 (GRCm39) missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105,406,292 (GRCm39) missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105,410,842 (GRCm39) missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105,411,770 (GRCm39) missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105,414,347 (GRCm39) missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105,415,397 (GRCm39) missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105,402,966 (GRCm39) missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105,404,059 (GRCm39) missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105,408,180 (GRCm39) missense probably benign
R4579:Dchs1 UTSW 7 105,403,972 (GRCm39) missense probably damaging 1.00
R4588:Dchs1 UTSW 7 105,405,248 (GRCm39) missense probably benign
R4613:Dchs1 UTSW 7 105,421,931 (GRCm39) missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105,403,562 (GRCm39) missense probably benign 0.02
R4696:Dchs1 UTSW 7 105,413,834 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,414,759 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4738:Dchs1 UTSW 7 105,407,880 (GRCm39) missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105,420,827 (GRCm39) missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105,415,133 (GRCm39) missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105,404,937 (GRCm39) missense probably benign 0.00
R4909:Dchs1 UTSW 7 105,415,462 (GRCm39) missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105,421,384 (GRCm39) missense probably benign 0.09
R5109:Dchs1 UTSW 7 105,414,221 (GRCm39) missense probably benign
R5126:Dchs1 UTSW 7 105,402,724 (GRCm39) missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105,404,865 (GRCm39) missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105,403,809 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,421,262 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105,404,500 (GRCm39) missense probably benign 0.11
R5623:Dchs1 UTSW 7 105,421,976 (GRCm39) missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105,422,016 (GRCm39) missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105,404,955 (GRCm39) missense probably benign 0.01
R5743:Dchs1 UTSW 7 105,420,803 (GRCm39) missense probably benign
R5759:Dchs1 UTSW 7 105,413,383 (GRCm39) missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105,422,247 (GRCm39) missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105,421,242 (GRCm39) missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105,408,373 (GRCm39) missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105,405,132 (GRCm39) missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105,403,302 (GRCm39) missense probably benign 0.08
R6065:Dchs1 UTSW 7 105,404,628 (GRCm39) missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105,410,132 (GRCm39) missense probably benign
R6137:Dchs1 UTSW 7 105,414,313 (GRCm39) missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105,414,145 (GRCm39) missense probably benign 0.05
R6363:Dchs1 UTSW 7 105,407,679 (GRCm39) missense probably benign 0.12
R6466:Dchs1 UTSW 7 105,413,748 (GRCm39) missense probably benign 0.09
R6544:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105,408,013 (GRCm39) missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105,412,120 (GRCm39) missense probably benign 0.17
R6632:Dchs1 UTSW 7 105,411,085 (GRCm39) missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105,406,210 (GRCm39) missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105,412,710 (GRCm39) missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105,406,228 (GRCm39) missense probably benign
R7064:Dchs1 UTSW 7 105,412,392 (GRCm39) missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105,411,078 (GRCm39) missense probably benign 0.04
R7191:Dchs1 UTSW 7 105,414,646 (GRCm39) missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105,404,338 (GRCm39) nonsense probably null
R7380:Dchs1 UTSW 7 105,407,835 (GRCm39) missense probably benign 0.35
R7438:Dchs1 UTSW 7 105,404,155 (GRCm39) missense probably benign 0.30
R7496:Dchs1 UTSW 7 105,411,066 (GRCm39) missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105,421,580 (GRCm39) missense probably benign 0.00
R7604:Dchs1 UTSW 7 105,415,189 (GRCm39) missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105,408,445 (GRCm39) missense probably benign
R7821:Dchs1 UTSW 7 105,414,352 (GRCm39) missense probably benign 0.00
R7834:Dchs1 UTSW 7 105,414,774 (GRCm39) missense probably benign 0.39
R7841:Dchs1 UTSW 7 105,412,180 (GRCm39) missense probably benign
R7913:Dchs1 UTSW 7 105,408,435 (GRCm39) missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105,404,395 (GRCm39) missense probably benign 0.45
R8076:Dchs1 UTSW 7 105,411,189 (GRCm39) missense probably damaging 1.00
R8076:Dchs1 UTSW 7 105,405,128 (GRCm39) missense possibly damaging 0.52
R8087:Dchs1 UTSW 7 105,402,706 (GRCm39) missense probably benign 0.41
R8125:Dchs1 UTSW 7 105,414,089 (GRCm39) missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105,411,824 (GRCm39) missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105,414,718 (GRCm39) missense probably benign 0.22
R8476:Dchs1 UTSW 7 105,408,015 (GRCm39) missense probably benign 0.05
R8497:Dchs1 UTSW 7 105,408,168 (GRCm39) missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105,420,945 (GRCm39) missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105,410,064 (GRCm39) missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105,404,597 (GRCm39) missense probably benign 0.00
R8948:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R8950:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R9029:Dchs1 UTSW 7 105,402,919 (GRCm39) missense probably benign 0.13
R9039:Dchs1 UTSW 7 105,405,215 (GRCm39) missense probably benign 0.11
R9081:Dchs1 UTSW 7 105,403,636 (GRCm39) missense probably benign 0.00
R9134:Dchs1 UTSW 7 105,404,910 (GRCm39) missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105,415,126 (GRCm39) missense probably benign
R9162:Dchs1 UTSW 7 105,414,732 (GRCm39) missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105,422,114 (GRCm39) missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105,404,833 (GRCm39) missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105,403,120 (GRCm39) missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105,415,402 (GRCm39) missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105,414,981 (GRCm39) critical splice donor site probably null
R9392:Dchs1 UTSW 7 105,421,869 (GRCm39) missense probably benign 0.09
R9619:Dchs1 UTSW 7 105,413,662 (GRCm39) missense probably benign 0.07
R9680:Dchs1 UTSW 7 105,411,625 (GRCm39) missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105,407,191 (GRCm39) missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105,412,682 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,406,900 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,407,758 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGAACCTCCTGAATGGACAGCC -3'
(R):5'- CGCTTCGAGCTGAAGATCGAGATG -3'

Sequencing Primer
(F):5'- CCAGGAGTTTAAATCTGGCAC -3'
(R):5'- AGATCGAGATGCTGGTGC -3'
Posted On 2013-04-24