Incidental Mutation 'R4222:Ptk7'
ID 319421
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene Name PTK7 protein tyrosine kinase 7
Synonyms 8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission 041042-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4222 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 46564451-46629504 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46574463 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 679 (M679K)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
AlphaFold Q8BKG3
Predicted Effect probably benign
Transcript: ENSMUST00000044442
AA Change: M679K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: M679K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,718,749 S1115T probably benign Het
Adgre4 A G 17: 55,785,121 Y127C probably damaging Het
AF366264 T C 8: 13,838,061 E10G probably benign Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Alkal1 A G 1: 6,388,615 K76R probably damaging Het
Atm T C 9: 53,480,669 S1807G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
Cyp3a11 A T 5: 145,860,466 Y368N probably damaging Het
Gar1 A T 3: 129,830,806 probably benign Het
Gm5265 A T 1: 169,453,801 noncoding transcript Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Hapln4 T A 8: 70,086,960 W214R probably damaging Het
Hist1h1b A T 13: 21,779,977 probably benign Het
Irgq C A 7: 24,533,625 A297D possibly damaging Het
Kri1 T C 9: 21,281,063 E145G probably benign Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mrpl22 T A 11: 58,171,867 probably benign Het
Myo7a T A 7: 98,073,229 Q1163L possibly damaging Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Nrxn3 G T 12: 89,532,992 G718* probably null Het
Olfm3 C T 3: 115,090,171 Q41* probably null Het
Olfr52 G T 2: 86,181,997 T38K probably damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Parm1 G A 5: 91,593,867 M31I probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Pkn2 A T 3: 142,793,866 L950* probably null Het
Plec C T 15: 76,177,319 R2671H probably damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptx3 C T 3: 66,224,706 T216I probably damaging Het
Rrp8 T C 7: 105,734,022 I346V possibly damaging Het
Rsrc1 A G 3: 66,994,567 K17E unknown Het
Ryr2 T A 13: 11,737,873 E1854V possibly damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Spag5 G A 11: 78,304,511 V215I probably damaging Het
Ston1 A G 17: 88,636,771 Y535C probably damaging Het
Tbc1d14 A T 5: 36,493,108 S395T probably benign Het
Tlr11 C T 14: 50,361,849 P431S probably damaging Het
Trerf1 G T 17: 47,314,801 noncoding transcript Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Ttc26 A G 6: 38,395,075 Y200C probably damaging Het
Vmn1r49 A G 6: 90,072,246 F258S probably benign Het
Vmn1r-ps103 C A 13: 22,442,028 noncoding transcript Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Zbtb5 A G 4: 44,993,855 probably null Het
Zfp35 T G 18: 24,003,189 F197V possibly damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46572652 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1846:Ptk7 UTSW 17 46576490 critical splice donor site probably null
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2472:Ptk7 UTSW 17 46576848 missense probably benign 0.35
R2937:Ptk7 UTSW 17 46572550 missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46576890 missense probably benign 0.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46579599 missense probably benign 0.00
R7394:Ptk7 UTSW 17 46591757 missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46571643 missense possibly damaging 0.81
R7949:Ptk7 UTSW 17 46586461 missense possibly damaging 0.64
R8773:Ptk7 UTSW 17 46566267 missense possibly damaging 0.88
R9059:Ptk7 UTSW 17 46566191 missense probably damaging 1.00
R9327:Ptk7 UTSW 17 46568051 missense probably benign 0.17
R9495:Ptk7 UTSW 17 46576818 missense possibly damaging 0.82
R9514:Ptk7 UTSW 17 46576818 missense possibly damaging 0.82
R9638:Ptk7 UTSW 17 46579593 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCAAATCCACAGCTGGCACG -3'
(R):5'- TCCAGGGTTAGTTCACAGGAC -3'

Sequencing Primer
(F):5'- AGGCACTCCATCTCTGGC -3'
(R):5'- TTAGTTCACAGGACCGAGTCAGC -3'
Posted On 2015-06-10