Incidental Mutation 'R4222:Trerf1'
ID 319422
Institutional Source Beutler Lab
Gene Symbol Trerf1
Ensembl Gene ENSMUSG00000064043
Gene Name transcriptional regulating factor 1
Synonyms 9430096I18Rik, Trep-132, Trep132
MMRRC Submission 041042-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.482) question?
Stock # R4222 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 47451801-47672883 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) G to T at 47625727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077951
SMART Domains Protein: ENSMUSP00000077103
Gene: ENSMUSG00000064043

DomainStartEndE-ValueType
low complexity region 262 279 N/A INTRINSIC
low complexity region 291 342 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
ZnF_C2H2 512 534 1.2e-3 SMART
low complexity region 552 580 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
low complexity region 690 704 N/A INTRINSIC
low complexity region 732 742 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
ELM2 807 863 7.65e-13 SMART
SANT 912 960 2.18e-5 SMART
coiled coil region 981 1005 N/A INTRINSIC
ZnF_C2H2 1039 1063 2.75e-3 SMART
low complexity region 1092 1106 N/A INTRINSIC
ZnF_C2H2 1112 1134 1.1e-2 SMART
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1182 1200 N/A INTRINSIC
low complexity region 1208 1222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191153
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcriptional regulating protein which interacts with CBP/p300 to regulate the human gene CYP11A1. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A G 17: 56,092,121 (GRCm39) Y127C probably damaging Het
Aif1l A T 2: 31,852,251 (GRCm39) S40C probably damaging Het
Alkal1 A G 1: 6,458,839 (GRCm39) K76R probably damaging Het
Atm T C 9: 53,391,969 (GRCm39) S1807G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 (GRCm39) noncoding transcript Het
Brd10 A T 19: 29,696,149 (GRCm39) S1115T probably benign Het
Cyp3a11 A T 5: 145,797,276 (GRCm39) Y368N probably damaging Het
Gar1 A T 3: 129,624,455 (GRCm39) probably benign Het
Gm5265 A T 1: 169,281,370 (GRCm39) noncoding transcript Het
Gm7964 T G 7: 83,406,030 (GRCm39) N281K probably damaging Het
Grin1 T C 2: 25,187,332 (GRCm39) probably benign Het
H1f5 A T 13: 21,964,147 (GRCm39) probably benign Het
Hapln4 T A 8: 70,539,610 (GRCm39) W214R probably damaging Het
Ift56 A G 6: 38,372,010 (GRCm39) Y200C probably damaging Het
Irgq C A 7: 24,233,050 (GRCm39) A297D possibly damaging Het
Kri1 T C 9: 21,192,359 (GRCm39) E145G probably benign Het
Lama3 T C 18: 12,583,460 (GRCm39) C683R probably damaging Het
Mrpl22 T A 11: 58,062,693 (GRCm39) probably benign Het
Myo7a T A 7: 97,722,436 (GRCm39) Q1163L possibly damaging Het
Nipsnap3a T A 4: 52,997,251 (GRCm39) D172E probably benign Het
Nrxn3 G T 12: 89,499,762 (GRCm39) G718* probably null Het
Olfm3 C T 3: 114,883,820 (GRCm39) Q41* probably null Het
Or52z12 A G 7: 103,233,966 (GRCm39) T246A probably damaging Het
Or8u8 G T 2: 86,012,341 (GRCm39) T38K probably damaging Het
Parm1 G A 5: 91,741,726 (GRCm39) M31I probably benign Het
Phc3 A T 3: 30,990,968 (GRCm39) S383R probably damaging Het
Pkn2 A T 3: 142,499,627 (GRCm39) L950* probably null Het
Plec C T 15: 76,061,519 (GRCm39) R2671H probably damaging Het
Ptbp1 T C 10: 79,695,047 (GRCm39) I125T probably benign Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Ptk7 A T 17: 46,885,389 (GRCm39) M679K probably benign Het
Ptx3 C T 3: 66,132,127 (GRCm39) T216I probably damaging Het
Rrp8 T C 7: 105,383,229 (GRCm39) I346V possibly damaging Het
Rsrc1 A G 3: 66,901,900 (GRCm39) K17E unknown Het
Ryr2 T A 13: 11,752,759 (GRCm39) E1854V possibly damaging Het
Semp2l2a T C 8: 13,888,061 (GRCm39) E10G probably benign Het
Slc25a45 A T 19: 5,930,146 (GRCm39) I39F probably damaging Het
Spag5 G A 11: 78,195,337 (GRCm39) V215I probably damaging Het
Ston1 A G 17: 88,944,199 (GRCm39) Y535C probably damaging Het
Tbc1d14 A T 5: 36,650,452 (GRCm39) S395T probably benign Het
Tlr11 C T 14: 50,599,306 (GRCm39) P431S probably damaging Het
Trim43b T A 9: 88,972,692 (GRCm39) Q154L probably benign Het
Vmn1r49 A G 6: 90,049,228 (GRCm39) F258S probably benign Het
Vmn1r-ps103 C A 13: 22,626,198 (GRCm39) noncoding transcript Het
Vmn2r14 A G 5: 109,364,149 (GRCm39) M589T probably benign Het
Vmn2r60 A T 7: 41,765,952 (GRCm39) T20S probably benign Het
Zbtb5 A G 4: 44,993,855 (GRCm39) probably null Het
Zfp35 T G 18: 24,136,246 (GRCm39) F197V possibly damaging Het
Other mutations in Trerf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Trerf1 APN 17 47,630,501 (GRCm39) unclassified noncoding transcript
IGL01753:Trerf1 APN 17 47,626,362 (GRCm39) exon noncoding transcript
IGL02172:Trerf1 APN 17 47,628,743 (GRCm39) exon noncoding transcript
IGL02266:Trerf1 APN 17 47,626,331 (GRCm39) exon noncoding transcript
IGL02370:Trerf1 APN 17 47,625,387 (GRCm39) exon noncoding transcript
IGL02613:Trerf1 APN 17 47,659,766 (GRCm39) exon noncoding transcript
R0179:Trerf1 UTSW 17 47,627,588 (GRCm39) critical splice donor site noncoding transcript
R0284:Trerf1 UTSW 17 47,630,471 (GRCm39) unclassified noncoding transcript
R0359:Trerf1 UTSW 17 47,652,062 (GRCm39) exon noncoding transcript
R0689:Trerf1 UTSW 17 47,630,300 (GRCm39) unclassified noncoding transcript
R1460:Trerf1 UTSW 17 47,628,771 (GRCm39) exon noncoding transcript
R1727:Trerf1 UTSW 17 47,652,092 (GRCm39) exon noncoding transcript
R4562:Trerf1 UTSW 17 47,637,997 (GRCm39) exon noncoding transcript
R4770:Trerf1 UTSW 17 47,630,581 (GRCm39) unclassified noncoding transcript
R5366:Trerf1 UTSW 17 47,626,116 (GRCm39) exon noncoding transcript
R5919:Trerf1 UTSW 17 47,634,208 (GRCm39) unclassified noncoding transcript
R5963:Trerf1 UTSW 17 47,625,263 (GRCm39) exon noncoding transcript
R5975:Trerf1 UTSW 17 47,625,197 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCCGTCAACTGCTGTCTCAG -3'
(R):5'- AGGTATCTGCAGTGAACTCTG -3'

Sequencing Primer
(F):5'- TGTCTCAGAAGCCCGTGGAG -3'
(R):5'- TGAACTCTGCCGCTGCTG -3'
Posted On 2015-06-10