Incidental Mutation 'R4223:Ppcdc'
ID 319464
Institutional Source Beutler Lab
Gene Symbol Ppcdc
Ensembl Gene ENSMUSG00000063849
Gene Name phosphopantothenoylcysteine decarboxylase
Synonyms 8430432M10Rik, 1810057I13Rik
MMRRC Submission 041043-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R4223 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 57292378-57347407 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57321998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 181 (M181L)
Ref Sequence ENSEMBL: ENSMUSP00000082856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085709] [ENSMUST00000213194] [ENSMUST00000213479] [ENSMUST00000214065] [ENSMUST00000214144] [ENSMUST00000214166] [ENSMUST00000214339] [ENSMUST00000214624] [ENSMUST00000215883] [ENSMUST00000216365]
AlphaFold Q8BZB2
Predicted Effect possibly damaging
Transcript: ENSMUST00000085709
AA Change: M181L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082856
Gene: ENSMUSG00000063849
AA Change: M181L

DomainStartEndE-ValueType
Pfam:Flavoprotein 18 149 7.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213194
Predicted Effect probably benign
Transcript: ENSMUST00000213479
Predicted Effect probably benign
Transcript: ENSMUST00000214065
Predicted Effect probably benign
Transcript: ENSMUST00000214144
Predicted Effect probably benign
Transcript: ENSMUST00000214166
Predicted Effect probably benign
Transcript: ENSMUST00000214339
Predicted Effect probably benign
Transcript: ENSMUST00000214624
Predicted Effect probably benign
Transcript: ENSMUST00000215883
Predicted Effect probably benign
Transcript: ENSMUST00000215961
Predicted Effect probably benign
Transcript: ENSMUST00000216365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217255
Meta Mutation Damage Score 0.4574 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 78,930,286 (GRCm39) Y43H probably damaging Het
Aamp A T 1: 74,320,285 (GRCm39) L348Q probably damaging Het
Abcb1b T A 5: 8,863,722 (GRCm39) L226M probably damaging Het
Acap1 A G 11: 69,774,511 (GRCm39) S396P probably damaging Het
Aif1l A T 2: 31,852,251 (GRCm39) S40C probably damaging Het
Atp1a3 T C 7: 24,700,355 (GRCm39) D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 (GRCm39) noncoding transcript Het
Ccdc116 A G 16: 16,964,809 (GRCm39) probably benign Het
Cmtm5 T A 14: 55,175,376 (GRCm39) C51S probably damaging Het
Cyb5rl T C 4: 106,938,185 (GRCm39) V214A probably damaging Het
Cyp4x1 A T 4: 114,970,077 (GRCm39) I350N probably damaging Het
Efcab6 C A 15: 83,751,309 (GRCm39) D1498Y probably damaging Het
Eif3c C G 7: 126,165,471 (GRCm39) probably benign Het
Epha3 G A 16: 63,403,902 (GRCm39) S733L probably damaging Het
Esyt1 T C 10: 128,356,517 (GRCm39) Y376C probably damaging Het
Galnt1 T C 18: 24,371,413 (GRCm39) F4L probably benign Het
Glis1 T C 4: 107,425,042 (GRCm39) S218P probably benign Het
Gm15854 A T 6: 129,949,426 (GRCm39) noncoding transcript Het
Gm29125 T C 1: 80,361,236 (GRCm39) noncoding transcript Het
Inpp5a T C 7: 139,138,821 (GRCm39) V263A possibly damaging Het
Itgb1 T G 8: 129,440,624 (GRCm39) I255S probably damaging Het
Kcp A G 6: 29,482,257 (GRCm39) L1547P possibly damaging Het
Kifc3 C A 8: 95,836,610 (GRCm39) L72F probably damaging Het
Lama3 T C 18: 12,583,460 (GRCm39) C683R probably damaging Het
Lrrc55 G A 2: 85,026,460 (GRCm39) A188V possibly damaging Het
Ly6i A T 15: 74,854,884 (GRCm39) S9T probably benign Het
Mfsd14b C T 13: 65,214,422 (GRCm39) probably benign Het
Nipsnap3a T A 4: 52,997,251 (GRCm39) D172E probably benign Het
Or4g7 A T 2: 111,309,489 (GRCm39) Y120F probably benign Het
Oxgr1 T C 14: 120,260,025 (GRCm39) K61E probably damaging Het
Pak2 G T 16: 31,871,028 (GRCm39) N51K probably benign Het
Pcdhgb7 T A 18: 37,886,856 (GRCm39) D675E probably benign Het
Pcolce T A 5: 137,603,389 (GRCm39) probably benign Het
Phc3 A T 3: 30,990,968 (GRCm39) S383R probably damaging Het
Phf1 C T 17: 27,156,474 (GRCm39) R539* probably null Het
Plch1 G A 3: 63,609,321 (GRCm39) T48I probably damaging Het
Plekha2 A G 8: 25,533,036 (GRCm39) S312P probably damaging Het
Pnpla7 T C 2: 24,872,126 (GRCm39) F69L possibly damaging Het
Ptbp1 T C 10: 79,695,047 (GRCm39) I125T probably benign Het
Rfc3 C A 5: 151,574,637 (GRCm39) probably benign Het
Rpa2 T G 4: 132,504,055 (GRCm39) I69S probably damaging Het
Rtn4 G A 11: 29,656,856 (GRCm39) V337I probably benign Het
Rttn T C 18: 89,113,708 (GRCm39) L1709P probably damaging Het
Sh2b2 G A 5: 136,247,907 (GRCm39) P548L possibly damaging Het
Slc12a2 T A 18: 58,043,328 (GRCm39) S591T probably damaging Het
Slc25a45 A T 19: 5,930,146 (GRCm39) I39F probably damaging Het
Slc38a9 G A 13: 112,850,782 (GRCm39) probably null Het
Slc9a4 T C 1: 40,658,286 (GRCm39) V603A probably damaging Het
Snx19 T G 9: 30,339,744 (GRCm39) V294G possibly damaging Het
Sp140l2 T C 1: 85,090,278 (GRCm39) D83G probably damaging Het
Sspo G T 6: 48,428,091 (GRCm39) V313L possibly damaging Het
Stard9 A G 2: 120,495,472 (GRCm39) T116A possibly damaging Het
Strn3 C T 12: 51,674,638 (GRCm39) R382Q probably damaging Het
Trim43b T A 9: 88,972,692 (GRCm39) Q154L probably benign Het
Trps1 A G 15: 50,710,044 (GRCm39) V98A probably benign Het
Vmn1r220 T A 13: 23,368,148 (GRCm39) M183L probably benign Het
Vmn2r60 A T 7: 41,765,952 (GRCm39) T20S probably benign Het
Wdr81 T C 11: 75,338,828 (GRCm39) T1444A probably benign Het
Xirp2 A T 2: 67,346,837 (GRCm39) E3026V possibly damaging Het
Other mutations in Ppcdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ppcdc APN 9 57,322,423 (GRCm39) missense probably benign 0.00
R0945:Ppcdc UTSW 9 57,327,441 (GRCm39) splice site probably null
R1666:Ppcdc UTSW 9 57,321,998 (GRCm39) missense possibly damaging 0.91
R3684:Ppcdc UTSW 9 57,328,408 (GRCm39) critical splice donor site probably null
R4821:Ppcdc UTSW 9 57,342,194 (GRCm39) missense probably benign 0.00
R5121:Ppcdc UTSW 9 57,328,446 (GRCm39) missense possibly damaging 0.56
R5236:Ppcdc UTSW 9 57,321,937 (GRCm39) missense probably benign 0.00
R7034:Ppcdc UTSW 9 57,322,453 (GRCm39) missense probably damaging 1.00
R7303:Ppcdc UTSW 9 57,321,958 (GRCm39) missense probably benign
R7591:Ppcdc UTSW 9 57,342,262 (GRCm39) missense probably damaging 1.00
R7835:Ppcdc UTSW 9 57,327,559 (GRCm39) missense probably benign 0.02
R8942:Ppcdc UTSW 9 57,342,265 (GRCm39) missense probably benign 0.00
R8944:Ppcdc UTSW 9 57,342,265 (GRCm39) missense probably benign 0.00
R9324:Ppcdc UTSW 9 57,342,280 (GRCm39) missense probably benign
R9378:Ppcdc UTSW 9 57,327,571 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAGGTTCAGGCTAGCCC -3'
(R):5'- AGACCAAGGTAGGCTTCTGTG -3'

Sequencing Primer
(F):5'- AGGCTAGCCCCTCGTCAAC -3'
(R):5'- CCATTGTGACCTTAGACAGAGCTG -3'
Posted On 2015-06-10