Incidental Mutation 'R4223:Wdr81'
ID319472
Institutional Source Beutler Lab
Gene Symbol Wdr81
Ensembl Gene ENSMUSG00000045374
Gene NameWD repeat domain 81
SynonymsMGC32441
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75440944-75454717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75448002 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1444 (T1444A)
Ref Sequence ENSEMBL: ENSMUSP00000134266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173320]
Predicted Effect unknown
Transcript: ENSMUST00000117392
AA Change: T1443A
SMART Domains Protein: ENSMUSP00000113939
Gene: ENSMUSG00000045374
AA Change: T1443A

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132442
AA Change: T325A
SMART Domains Protein: ENSMUSP00000120605
Gene: ENSMUSG00000045374
AA Change: T325A

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 23 47 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
WD40 512 551 3.19e-7 SMART
WD40 561 598 1.18e2 SMART
WD40 601 670 3.55e1 SMART
Blast:WD40 673 710 3e-14 BLAST
WD40 715 756 4.26e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135804
Predicted Effect probably benign
Transcript: ENSMUST00000173320
AA Change: T1444A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134266
Gene: ENSMUSG00000045374
AA Change: T1444A

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit weight loss, tremors, ataxia and an abnormal gait, as well as abnormal mitochondria in Purkinje cell dendrites, Purkinje cell degeneration, photoreceptor cell loss, and decreased total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Wdr81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Wdr81 APN 11 75445601 missense probably damaging 1.00
IGL02047:Wdr81 APN 11 75445506 missense probably damaging 1.00
IGL02103:Wdr81 APN 11 75444720 missense probably damaging 1.00
IGL02506:Wdr81 APN 11 75444406 missense probably benign 0.44
jello UTSW 11 75441812 missense probably damaging 1.00
R1184:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R1560:Wdr81 UTSW 11 75451623 nonsense probably null
R1680:Wdr81 UTSW 11 75454423 missense probably benign
R1689:Wdr81 UTSW 11 75445596 missense probably damaging 0.99
R2021:Wdr81 UTSW 11 75445962 nonsense probably null
R2104:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R2113:Wdr81 UTSW 11 75453635 missense probably benign 0.07
R2198:Wdr81 UTSW 11 75446081 missense probably benign 0.00
R2393:Wdr81 UTSW 11 75449405 missense probably damaging 1.00
R2400:Wdr81 UTSW 11 75449035 missense probably benign
R2850:Wdr81 UTSW 11 75451172 missense probably damaging 1.00
R3410:Wdr81 UTSW 11 75452932 missense probably damaging 0.97
R3764:Wdr81 UTSW 11 75452803 missense probably damaging 1.00
R4351:Wdr81 UTSW 11 75441812 missense probably damaging 1.00
R4594:Wdr81 UTSW 11 75445794 missense probably benign 0.00
R4601:Wdr81 UTSW 11 75445658 missense probably damaging 1.00
R4647:Wdr81 UTSW 11 75445988 missense probably damaging 0.98
R4651:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4652:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4930:Wdr81 UTSW 11 75451924 missense probably benign
R4966:Wdr81 UTSW 11 75445949 missense probably benign 0.34
R5075:Wdr81 UTSW 11 75452481 missense probably benign 0.00
R5412:Wdr81 UTSW 11 75450794 missense probably null 1.00
R5426:Wdr81 UTSW 11 75450896 missense possibly damaging 0.87
R5540:Wdr81 UTSW 11 75449070 missense probably damaging 1.00
R5544:Wdr81 UTSW 11 75441797 missense probably damaging 1.00
R5632:Wdr81 UTSW 11 75445906 missense probably damaging 0.99
R5650:Wdr81 UTSW 11 75444748 missense probably damaging 1.00
R5679:Wdr81 UTSW 11 75452923 missense probably damaging 1.00
R5978:Wdr81 UTSW 11 75444398 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6412:Wdr81 UTSW 11 75451163 missense probably benign 0.16
R6479:Wdr81 UTSW 11 75452105 missense possibly damaging 0.92
R6992:Wdr81 UTSW 11 75451786 missense probably benign 0.00
R7148:Wdr81 UTSW 11 75446002 missense
R7340:Wdr81 UTSW 11 75444699 missense probably null
R7739:Wdr81 UTSW 11 75441985 missense
R7823:Wdr81 UTSW 11 75449801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTCCATTGCTGACTCTGG -3'
(R):5'- AGTGGCCACCTTCTTCCAAG -3'

Sequencing Primer
(F):5'- GAGATGTAGTCACCAACTCTGTGC -3'
(R):5'- CCAAGTCTTCTCTCATCTGCATG -3'
Posted On2015-06-10