Incidental Mutation 'R4223:Epha3'
ID319484
Institutional Source Beutler Lab
Gene Symbol Epha3
Ensembl Gene ENSMUSG00000052504
Gene NameEph receptor A3
SynonymsTyro4, End3, Cek4, Hek, Hek4, Mek4
MMRRC Submission 041043-MU
Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location63543534-63864175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63583539 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 733 (S733L)
Ref Sequence ENSEMBL: ENSMUSP00000066554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000232049]
Predicted Effect probably damaging
Transcript: ENSMUST00000064405
AA Change: S733L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: S733L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EPH_lbd 29 202 1.76e-127 SMART
Pfam:GCC2_GCC3 263 306 6.6e-9 PFAM
FN3 326 418 1.14e-5 SMART
FN3 437 518 4.8e-13 SMART
Pfam:EphA2_TM 543 619 8.2e-25 PFAM
TyrKc 622 879 5.16e-140 SMART
SAM 909 976 1.08e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232049
AA Change: S732L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Epha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Epha3 APN 16 63566684 missense probably damaging 1.00
IGL01358:Epha3 APN 16 63595746 splice site probably benign
IGL01713:Epha3 APN 16 63552562 missense probably benign 0.00
IGL02371:Epha3 APN 16 63585020 critical splice acceptor site probably null
IGL03111:Epha3 APN 16 63653446 missense probably damaging 0.98
IGL03208:Epha3 APN 16 63611089 missense probably damaging 1.00
laterality UTSW 16 63568399 missense probably damaging 1.00
midline UTSW 16 63844144 missense possibly damaging 0.46
stride UTSW 16 63552494 missense probably benign 0.00
F2404:Epha3 UTSW 16 63546168 missense probably benign 0.14
P0041:Epha3 UTSW 16 63612868 missense probably damaging 1.00
PIT4498001:Epha3 UTSW 16 63552526 missense probably damaging 1.00
PIT4585001:Epha3 UTSW 16 63566577 critical splice donor site probably null
R0147:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0148:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0336:Epha3 UTSW 16 63566648 missense probably damaging 1.00
R0738:Epha3 UTSW 16 63595612 missense probably damaging 1.00
R0833:Epha3 UTSW 16 63603519 splice site probably benign
R0836:Epha3 UTSW 16 63603519 splice site probably benign
R0969:Epha3 UTSW 16 63566636 missense probably damaging 1.00
R1160:Epha3 UTSW 16 63773068 missense probably damaging 1.00
R1205:Epha3 UTSW 16 63598248 frame shift probably null
R1349:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1372:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1500:Epha3 UTSW 16 63595662 missense probably benign 0.06
R1523:Epha3 UTSW 16 63610948 missense probably damaging 0.99
R1532:Epha3 UTSW 16 63546178 missense probably benign 0.08
R1544:Epha3 UTSW 16 63773053 missense probably damaging 1.00
R1681:Epha3 UTSW 16 63595728 missense probably damaging 1.00
R1708:Epha3 UTSW 16 63583507 missense probably damaging 1.00
R1803:Epha3 UTSW 16 63602288 missense probably benign 0.00
R1893:Epha3 UTSW 16 63568399 missense probably damaging 1.00
R1957:Epha3 UTSW 16 63772952 missense probably benign 0.00
R2144:Epha3 UTSW 16 63773317 missense possibly damaging 0.86
R2190:Epha3 UTSW 16 63546189 missense probably benign 0.05
R2198:Epha3 UTSW 16 63844144 missense possibly damaging 0.46
R2344:Epha3 UTSW 16 63652383 missense possibly damaging 0.67
R2504:Epha3 UTSW 16 63603625 missense probably damaging 0.97
R2911:Epha3 UTSW 16 63652412 missense probably benign
R3889:Epha3 UTSW 16 63610964 missense probably damaging 1.00
R4836:Epha3 UTSW 16 63583557 missense probably damaging 1.00
R4981:Epha3 UTSW 16 63652412 missense probably benign 0.04
R5044:Epha3 UTSW 16 63602287 missense possibly damaging 0.79
R5195:Epha3 UTSW 16 63546147 missense possibly damaging 0.86
R5248:Epha3 UTSW 16 63598257 missense probably damaging 1.00
R5478:Epha3 UTSW 16 63583533 missense probably damaging 1.00
R6052:Epha3 UTSW 16 63603604 missense possibly damaging 0.94
R6167:Epha3 UTSW 16 63612924 missense probably benign 0.00
R6337:Epha3 UTSW 16 63568443 missense probably damaging 1.00
R6342:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R6793:Epha3 UTSW 16 63773455 missense probably benign 0.01
R6908:Epha3 UTSW 16 63598249 missense probably damaging 1.00
R7029:Epha3 UTSW 16 63773335 missense probably benign 0.37
R7059:Epha3 UTSW 16 63568455 missense probably damaging 1.00
R7175:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R7204:Epha3 UTSW 16 63652332 missense probably benign
R7217:Epha3 UTSW 16 63552494 missense probably benign 0.00
R7315:Epha3 UTSW 16 63552609 missense probably benign 0.00
R7389:Epha3 UTSW 16 63772984 missense probably damaging 1.00
R7419:Epha3 UTSW 16 63598294 missense probably damaging 1.00
R7572:Epha3 UTSW 16 63611080 nonsense probably null
R7667:Epha3 UTSW 16 63566600 missense probably benign 0.21
R7686:Epha3 UTSW 16 63773288 missense probably damaging 1.00
R7855:Epha3 UTSW 16 63773560 missense probably damaging 1.00
R7938:Epha3 UTSW 16 63773560 missense probably damaging 1.00
Z1176:Epha3 UTSW 16 63585012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGAAATCTCCATTACTCACCCTGG -3'
(R):5'- TGCAGCCACATCAATTTTGCATTG -3'

Sequencing Primer
(F):5'- ACTCACCCTGGTTGTGTAAG -3'
(R):5'- CACATCAATTTTGCATTGGCTGTG -3'
Posted On2015-06-10