Mutagenetix > Incidental Mutation

Incidental Mutation 'R4223:Slc12a2'

319489

Institutional Source

Beutler Lab

Gene Symbol

Slc12a2

Ensembl Gene

ENSMUSG00000024597

Gene Name

solute carrier family 12, member 2

Synonyms

Nkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters

MMRRC Submission

041043-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4223 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57878678-57946821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57910256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 591 (S591T)

Ref Sequence

ENSEMBL: ENSMUSP00000111023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115366]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000115366
AA Change: S591T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: S591T

Domain	Start	End	E-Value	Type
low complexity region	3	33	N/A	INTRINSIC
low complexity region	43	59	N/A	INTRINSIC
SCOP:d1gkub1	91	122	4e-3	SMART
low complexity region	141	162	N/A	INTRINSIC
low complexity region	175	190	N/A	INTRINSIC
Pfam:AA_permease_N	196	260	5.9e-29	PFAM
Pfam:AA_permease	284	787	4.1e-154	PFAM
Pfam:AA_permease_2	290	743	8.7e-22	PFAM
Pfam:SLC12	795	1206	2.7e-167	PFAM

Meta Mutation Damage Score

0.5060

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	A	G	10: 79,094,452	Y43H	probably damaging	Het
Aamp	A	T	1: 74,281,126	L348Q	probably damaging	Het
Abcb1b	T	A	5: 8,813,722	L226M	probably damaging	Het
Acap1	A	G	11: 69,883,685	S396P	probably damaging	Het
Aif1l	A	T	2: 31,962,239	S40C	probably damaging	Het
Atp1a3	T	C	7: 25,000,930	D48G	probably benign	Het
Bhmt-ps1	T	A	4: 26,369,352		noncoding transcript	Het
C130026I21Rik	T	C	1: 85,112,557	D83G	probably damaging	Het
Ccdc116	A	G	16: 17,146,945		probably benign	Het
Cmtm5	T	A	14: 54,937,919	C51S	probably damaging	Het
Cyb5rl	T	C	4: 107,080,988	V214A	probably damaging	Het
Cyp4x1	A	T	4: 115,112,880	I350N	probably damaging	Het
Efcab6	C	A	15: 83,867,108	D1498Y	probably damaging	Het
Eif3c	C	G	7: 126,566,299		probably benign	Het
Epha3	G	A	16: 63,583,539	S733L	probably damaging	Het
Esyt1	T	C	10: 128,520,648	Y376C	probably damaging	Het
Galnt1	T	C	18: 24,238,356	F4L	probably benign	Het
Glis1	T	C	4: 107,567,845	S218P	probably benign	Het
Gm15854	A	T	6: 129,972,463		noncoding transcript	Het
Gm29125	T	C	1: 80,383,519		noncoding transcript	Het
Inpp5a	T	C	7: 139,558,905	V263A	possibly damaging	Het
Itgb1	T	G	8: 128,714,143	I255S	probably damaging	Het
Kcp	A	G	6: 29,482,258	L1547P	possibly damaging	Het
Kifc3	C	A	8: 95,109,982	L72F	probably damaging	Het
Lama3	T	C	18: 12,450,403	C683R	probably damaging	Het
Lrrc55	G	A	2: 85,196,116	A188V	possibly damaging	Het
Ly6i	A	T	15: 74,983,035	S9T	probably benign	Het
Mfsd14b	C	T	13: 65,066,608		probably benign	Het
Nipsnap3a	T	A	4: 52,997,251	D172E	probably benign	Het
Olfr1288	A	T	2: 111,479,144	Y120F	probably benign	Het
Oxgr1	T	C	14: 120,022,613	K61E	probably damaging	Het
Pak2	G	T	16: 32,052,210	N51K	probably benign	Het
Pcdhgb7	T	A	18: 37,753,803	D675E	probably benign	Het
Pcolce	T	A	5: 137,605,127		probably benign	Het
Phc3	A	T	3: 30,936,819	S383R	probably damaging	Het
Phf1	C	T	17: 26,937,500	R539*	probably null	Het
Plch1	G	A	3: 63,701,900	T48I	probably damaging	Het
Plekha2	A	G	8: 25,043,020	S312P	probably damaging	Het
Pnpla7	T	C	2: 24,982,114	F69L	possibly damaging	Het
Ppcdc	T	A	9: 57,414,715	M181L	possibly damaging	Het
Ptbp1	T	C	10: 79,859,213	I125T	probably benign	Het
Rfc3	C	A	5: 151,651,172		probably benign	Het
Rpa2	T	G	4: 132,776,744	I69S	probably damaging	Het
Rtn4	G	A	11: 29,706,856	V337I	probably benign	Het
Rttn	T	C	18: 89,095,584	L1709P	probably damaging	Het
Sh2b2	G	A	5: 136,219,053	P548L	possibly damaging	Het
Slc25a45	A	T	19: 5,880,118	I39F	probably damaging	Het
Slc38a9	G	A	13: 112,714,248		probably null	Het
Slc9a4	T	C	1: 40,619,126	V603A	probably damaging	Het
Snx19	T	G	9: 30,428,448	V294G	possibly damaging	Het
Sspo	G	T	6: 48,451,157	V313L	possibly damaging	Het
Stard9	A	G	2: 120,664,991	T116A	possibly damaging	Het
Strn3	C	T	12: 51,627,855	R382Q	probably damaging	Het
Trim43b	T	A	9: 89,090,639	Q154L	probably benign	Het
Trps1	A	G	15: 50,846,648	V98A	probably benign	Het
Vmn1r220	T	A	13: 23,183,978	M183L	probably benign	Het
Vmn2r60	A	T	7: 42,116,528	T20S	probably benign	Het
Wdr81	T	C	11: 75,448,002	T1444A	probably benign	Het
Xirp2	A	T	2: 67,516,493	E3026V	possibly damaging	Het

Other mutations in Slc12a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Slc12a2	APN	18	57936405	missense	probably damaging	1.00
IGL01099:Slc12a2	APN	18	57906020	nonsense	probably null
IGL01896:Slc12a2	APN	18	57896308	missense	probably benign	0.06
IGL02266:Slc12a2	APN	18	57912020	splice site	probably benign
IGL02489:Slc12a2	APN	18	57912002	missense	probably damaging	0.98
IGL02681:Slc12a2	APN	18	57879399	missense	probably benign	0.25
IGL03068:Slc12a2	APN	18	57904335	splice site	probably benign
IGL03076:Slc12a2	APN	18	57926397	splice site	probably benign
IGL03086:Slc12a2	APN	18	57921784	missense	probably benign	0.00
IGL03238:Slc12a2	APN	18	57914234	missense	possibly damaging	0.85
frankie	UTSW	18	57934963	missense	possibly damaging	0.48
honeylamb	UTSW	18	57930166	missense	probably damaging	1.00
sugar	UTSW	18	57899272	missense	probably damaging	1.00
R0048:Slc12a2	UTSW	18	57915522	splice site	probably benign
R0194:Slc12a2	UTSW	18	57930211	missense	probably damaging	1.00
R0530:Slc12a2	UTSW	18	57919536	missense	possibly damaging	0.76
R0959:Slc12a2	UTSW	18	57904378	missense	probably damaging	1.00
R1014:Slc12a2	UTSW	18	57921810	missense	probably benign	0.00
R1112:Slc12a2	UTSW	18	57937752	missense	probably benign	0.01
R1544:Slc12a2	UTSW	18	57879302	missense	probably benign	0.00
R1669:Slc12a2	UTSW	18	57904235	missense	probably damaging	0.99
R1935:Slc12a2	UTSW	18	57904353	missense	possibly damaging	0.95
R1951:Slc12a2	UTSW	18	57879395	missense	possibly damaging	0.51
R1990:Slc12a2	UTSW	18	57910286	missense	possibly damaging	0.61
R2340:Slc12a2	UTSW	18	57900050	missense	probably benign	0.03
R3971:Slc12a2	UTSW	18	57930196	missense	possibly damaging	0.84
R4120:Slc12a2	UTSW	18	57899355	missense	possibly damaging	0.95
R4541:Slc12a2	UTSW	18	57912965	splice site	probably null
R4678:Slc12a2	UTSW	18	57905960	nonsense	probably null
R4931:Slc12a2	UTSW	18	57934963	missense	possibly damaging	0.48
R5114:Slc12a2	UTSW	18	57899272	missense	probably damaging	1.00
R5226:Slc12a2	UTSW	18	57879020	missense	probably damaging	1.00
R5648:Slc12a2	UTSW	18	57896310	missense	possibly damaging	0.83
R5726:Slc12a2	UTSW	18	57896354	missense	probably benign	0.01
R5789:Slc12a2	UTSW	18	57912019	splice site	probably null
R5868:Slc12a2	UTSW	18	57943996	missense	probably damaging	1.00
R5921:Slc12a2	UTSW	18	57932523	missense	probably benign	0.06
R6126:Slc12a2	UTSW	18	57944044	missense	possibly damaging	0.94
R6310:Slc12a2	UTSW	18	57915506	missense	probably damaging	0.99
R6598:Slc12a2	UTSW	18	57898073	missense	probably benign	0.01
R6615:Slc12a2	UTSW	18	57898128	missense	probably damaging	1.00
R6911:Slc12a2	UTSW	18	57919469	missense	probably benign	0.05
R6957:Slc12a2	UTSW	18	57910272	nonsense	probably null
R7411:Slc12a2	UTSW	18	57941013	missense	probably benign	0.01
R7508:Slc12a2	UTSW	18	57904393	missense	probably benign	0.01
R7645:Slc12a2	UTSW	18	57896378	missense	possibly damaging	0.94
R7658:Slc12a2	UTSW	18	57932524	missense	probably benign	0.02
R8054:Slc12a2	UTSW	18	57921872	nonsense	probably null
R8093:Slc12a2	UTSW	18	57879351	missense	probably benign	0.17
R8099:Slc12a2	UTSW	18	57899392	missense	probably damaging	0.99
R8121:Slc12a2	UTSW	18	57899331	missense	probably benign	0.44
R8214:Slc12a2	UTSW	18	57937719	missense	probably benign	0.29
R8273:Slc12a2	UTSW	18	57914266	splice site	probably benign
R8341:Slc12a2	UTSW	18	57879209	missense	possibly damaging	0.48
R8485:Slc12a2	UTSW	18	57941146	critical splice donor site	probably null
R8797:Slc12a2	UTSW	18	57879383	missense	possibly damaging	0.80
R9049:Slc12a2	UTSW	18	57921791	nonsense	probably null
R9180:Slc12a2	UTSW	18	57936397	missense	possibly damaging	0.83
R9256:Slc12a2	UTSW	18	57941795	missense	probably damaging	1.00
R9337:Slc12a2	UTSW	18	57930166	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACGCCTTTAAGGATGTTTTAGTAG -3'
(R):5'- CAATGTTTGAACAGTCCTACATAGC -3'

Sequencing Primer
(F):5'- GCTATTACCAGATTCCTTTCAG -3'
(R):5'- CAAACACTTTCAGATAAAGGT -3'

Posted On

2015-06-10