Incidental Mutation 'R4223:Rttn'
ID 319490
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Name rotatin
Synonyms C530033I08Rik, 4921538A15Rik
MMRRC Submission 041043-MU
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288
Essential gene? Essential (E-score: 1.000) question?
Stock # R4223 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 88971790-89131013 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89095584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1709 (L1709P)
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
AlphaFold Q8R4Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000023828
AA Change: L1709P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: L1709P

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Meta Mutation Damage Score 0.5029 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
Fascisti UTSW 18 89009460 splice site probably benign
marcher UTSW 18 89037946 missense probably damaging 0.99
militaristi UTSW 18 89010916 missense probably damaging 1.00
Thoughtless UTSW 18 89014611 missense probably damaging 1.00
twister UTSW 18 89046162 critical splice donor site probably null
Vermiculus UTSW 18 89090433 missense probably benign
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 splice site probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 splice site probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
R8029:Rttn UTSW 18 89090474 missense not run
R8085:Rttn UTSW 18 89053548 nonsense probably null
R8113:Rttn UTSW 18 89010916 missense probably damaging 1.00
R8355:Rttn UTSW 18 89028892 missense probably benign 0.05
R8531:Rttn UTSW 18 89113343 missense probably benign 0.00
R8992:Rttn UTSW 18 88977708 missense probably benign 0.24
R9008:Rttn UTSW 18 89009432 missense probably damaging 1.00
R9139:Rttn UTSW 18 89020137 missense probably benign 0.30
R9210:Rttn UTSW 18 89046162 critical splice donor site probably null
R9212:Rttn UTSW 18 89046162 critical splice donor site probably null
R9286:Rttn UTSW 18 88977725 missense probably benign 0.06
R9368:Rttn UTSW 18 89060452 missense probably damaging 1.00
R9632:Rttn UTSW 18 89017210 missense possibly damaging 0.82
R9710:Rttn UTSW 18 89017210 missense possibly damaging 0.82
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACACTATGATGCCACTGAGATAGG -3'
(R):5'- TCCAAGTACCTACACGGCAG -3'

Sequencing Primer
(F):5'- GGCTTCCTTTTTCTTGGAAT -3'
(R):5'- TCTGTTTTAGAGGATCCGTTAACC -3'
Posted On 2015-06-10