Incidental Mutation 'R4176:Pbx1'
ID319493
Institutional Source Beutler Lab
Gene Symbol Pbx1
Ensembl Gene ENSMUSG00000052534
Gene Namepre B cell leukemia homeobox 1
SynonymsPbx1b, Pbx1a, D230003C07Rik, Pbx-1, 2310056B04Rik
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location168119364-168432270 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 168191272 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064438] [ENSMUST00000072863] [ENSMUST00000176540] [ENSMUST00000176790] [ENSMUST00000188912]
Predicted Effect probably benign
Transcript: ENSMUST00000064438
SMART Domains Protein: ENSMUSP00000066385
Gene: ENSMUSG00000052534

DomainStartEndE-ValueType
Pfam:PBC 35 232 2e-106 PFAM
HOX 233 290 5.15e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072863
SMART Domains Protein: ENSMUSP00000072640
Gene: ENSMUSG00000052534

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176540
SMART Domains Protein: ENSMUSP00000135516
Gene: ENSMUSG00000052534

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:PBC 40 232 6.9e-98 PFAM
HOX 233 298 6.17e-18 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176790
SMART Domains Protein: ENSMUSP00000134925
Gene: ENSMUSG00000052534

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188912
SMART Domains Protein: ENSMUSP00000140606
Gene: ENSMUSG00000052534

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homeobox protein that belongs to the three-amino-acid loop extension/Pre-B cell leukemia transcription factor (TALE/PBX) family of proteins. The encoded protein is involved in several biological processes during embryogenesis including steroidogenesis, sexual development and the maintenance of hematopoietic stem cells. This protein functions in the development of several organ systems and plays a role in skeletal patterning and programming. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous disruption of this gene causes late gestational death, hypoplasia/aplasia of many organs, impaired hematopoiesis, anemia, skin edema, axial and appendicular skeleton defects, absent adrenal glands, abnormal chondrocyte differentiation, and abnormal bone, kidney and pancreas development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Pbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Pbx1 APN 1 168191304 missense probably benign 0.00
IGL02256:Pbx1 APN 1 168183602 missense possibly damaging 0.88
IGL03040:Pbx1 APN 1 168427946 splice site probably benign
root_cause UTSW 1 168209534 missense probably damaging 1.00
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0947:Pbx1 UTSW 1 168203366 missense probably damaging 1.00
R1785:Pbx1 UTSW 1 168431378 missense probably benign 0.09
R1893:Pbx1 UTSW 1 168203410 missense possibly damaging 0.91
R3552:Pbx1 UTSW 1 168158793 missense possibly damaging 0.88
R4757:Pbx1 UTSW 1 168195881 missense probably damaging 1.00
R5024:Pbx1 UTSW 1 168183589 missense possibly damaging 0.93
R6102:Pbx1 UTSW 1 168183565 missense probably benign 0.05
R6296:Pbx1 UTSW 1 168183615 missense possibly damaging 0.71
R6302:Pbx1 UTSW 1 168191341 missense probably benign
R6488:Pbx1 UTSW 1 168191395 missense probably damaging 1.00
R6501:Pbx1 UTSW 1 168209534 missense probably damaging 1.00
R7014:Pbx1 UTSW 1 168431380 missense probably damaging 0.98
R7070:Pbx1 UTSW 1 168195768 missense probably damaging 0.98
R7677:Pbx1 UTSW 1 168203426 missense probably damaging 0.99
X0024:Pbx1 UTSW 1 168431365 nonsense probably null
X0027:Pbx1 UTSW 1 168183612 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTGCAGACAGCCCCACCTTA -3'
(R):5'- GCTGAAGAGCTAATTCTCCCT -3'

Sequencing Primer
(F):5'- CCTTAAAAAGCACACTGTCCTTTGG -3'
(R):5'- TCTCCTGCTGCTCTAGGTATCAAAC -3'
Posted On2015-06-10