Incidental Mutation 'R4176:Fnbp1'
ID319495
Institutional Source Beutler Lab
Gene Symbol Fnbp1
Ensembl Gene ENSMUSG00000075415
Gene Nameformin binding protein 1
Synonyms2210010H06Rik, FBP17, FBP1, 1110057E06Rik
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31026206-31142008 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31036119 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000073879] [ENSMUST00000073879] [ENSMUST00000075326] [ENSMUST00000075326] [ENSMUST00000100207] [ENSMUST00000100207] [ENSMUST00000100208] [ENSMUST00000100208] [ENSMUST00000113555] [ENSMUST00000113555] [ENSMUST00000113559] [ENSMUST00000113560] [ENSMUST00000113562] [ENSMUST00000113564]
Predicted Effect probably null
Transcript: ENSMUST00000073879
SMART Domains Protein: ENSMUSP00000109188
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000073879
SMART Domains Protein: ENSMUSP00000109188
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000075326
SMART Domains Protein: ENSMUSP00000074796
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 360 451 1e-26 PDB
low complexity region 503 512 N/A INTRINSIC
SH3 518 575 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000075326
SMART Domains Protein: ENSMUSP00000074796
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 360 451 1e-26 PDB
low complexity region 503 512 N/A INTRINSIC
SH3 518 575 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100207
SMART Domains Protein: ENSMUSP00000097781
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 338 424 1e-26 PDB
low complexity region 476 485 N/A INTRINSIC
SH3 491 548 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100207
SMART Domains Protein: ENSMUSP00000097781
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 338 424 1e-26 PDB
low complexity region 476 485 N/A INTRINSIC
SH3 491 548 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100208
SMART Domains Protein: ENSMUSP00000097782
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 394 480 2e-26 PDB
low complexity region 532 541 N/A INTRINSIC
SH3 547 604 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100208
SMART Domains Protein: ENSMUSP00000097782
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 394 480 2e-26 PDB
low complexity region 532 541 N/A INTRINSIC
SH3 547 604 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113555
SMART Domains Protein: ENSMUSP00000109184
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 370 456 1e-26 PDB
low complexity region 508 517 N/A INTRINSIC
SH3 523 580 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113555
SMART Domains Protein: ENSMUSP00000109184
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 370 456 1e-26 PDB
low complexity region 508 517 N/A INTRINSIC
SH3 523 580 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113559
SMART Domains Protein: ENSMUSP00000109189
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
PDB:2EFL|A 1 221 1e-144 PDB
low complexity region 250 262 N/A INTRINSIC
PDB:2KE4|A 300 391 1e-26 PDB
low complexity region 443 452 N/A INTRINSIC
SH3 458 515 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113560
SMART Domains Protein: ENSMUSP00000109190
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 399 485 2e-26 PDB
low complexity region 537 546 N/A INTRINSIC
SH3 552 609 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113562
SMART Domains Protein: ENSMUSP00000109192
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113564
SMART Domains Protein: ENSMUSP00000109194
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 472 481 N/A INTRINSIC
SH3 487 544 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128431
Predicted Effect probably null
Transcript: ENSMUST00000128431
Predicted Effect probably null
Transcript: ENSMUST00000128500
SMART Domains Protein: ENSMUSP00000115013
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
Pfam:FCH 1 80 7.7e-20 PFAM
PDB:2KE4|A 167 253 2e-27 PDB
low complexity region 305 314 N/A INTRINSIC
SH3 320 377 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128500
SMART Domains Protein: ENSMUSP00000115013
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
Pfam:FCH 1 80 7.7e-20 PFAM
PDB:2KE4|A 167 253 2e-27 PDB
low complexity region 305 314 N/A INTRINSIC
SH3 320 377 3.2e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138581
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the formin-binding-protein family. The protein contains an N-terminal Fer/Cdc42-interacting protein 4 (CIP4) homology (FCH) domain followed by a coiled-coil domain, a proline-rich motif, a second coiled-coil domain, a Rho family protein-binding domain (RBD), and a C-terminal SH3 domain. This protein binds sorting nexin 2 (SNX2), tankyrase (TNKS), and dynamin; an interaction between this protein and formin has not been demonstrated yet in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Fnbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Fnbp1 APN 2 31083042 missense probably damaging 1.00
IGL01640:Fnbp1 APN 2 31105291 missense probably damaging 1.00
R0381:Fnbp1 UTSW 2 31033029 missense probably benign 0.02
R0573:Fnbp1 UTSW 2 31058978 missense probably damaging 1.00
R0713:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1120:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1364:Fnbp1 UTSW 2 31059031 splice site probably benign
R1974:Fnbp1 UTSW 2 31053047 missense probably null 0.94
R3800:Fnbp1 UTSW 2 31033131 missense probably damaging 1.00
R4293:Fnbp1 UTSW 2 31105350 missense probably damaging 1.00
R4478:Fnbp1 UTSW 2 31105254 missense probably damaging 1.00
R4602:Fnbp1 UTSW 2 31036540 critical splice donor site probably null
R4716:Fnbp1 UTSW 2 31055520 missense probably benign 0.03
R5909:Fnbp1 UTSW 2 31048199 splice site probably null
R6436:Fnbp1 UTSW 2 31096127 missense probably damaging 1.00
R7075:Fnbp1 UTSW 2 31058914 missense probably benign
R7747:Fnbp1 UTSW 2 31036147 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCATCTGTCACTTCAGTTGCAG -3'
(R):5'- CTCCAGGTTGGTCGCTATAG -3'

Sequencing Primer
(F):5'- TCACTTCAGTTGCAGAGGAC -3'
(R):5'- CCAGGTTGGTCGCTATAGTTGTCC -3'
Posted On2015-06-10