Incidental Mutation 'R4176:Ptpn22'
ID319500
Institutional Source Beutler Lab
Gene Symbol Ptpn22
Ensembl Gene ENSMUSG00000027843
Gene Nameprotein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms70zpep, Ptpn8
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103859795-103912247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103886245 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 571 (T571A)
Ref Sequence ENSEMBL: ENSMUSP00000029433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000146071]
PDB Structure
Solution structure of the SH3 domain from C-terminal Src Kinase complexed with a peptide from the tyrosine phosphatase PEP [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029433
AA Change: T571A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843
AA Change: T571A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134373
Predicted Effect probably benign
Transcript: ENSMUST00000146071
AA Change: T571A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843
AA Change: T571A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198701
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Ptpn22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Ptpn22 APN 3 103903374 missense probably benign 0.01
IGL01373:Ptpn22 APN 3 103886204 missense probably damaging 0.99
IGL01943:Ptpn22 APN 3 103886336 missense probably benign 0.02
IGL02092:Ptpn22 APN 3 103877321 missense probably damaging 1.00
IGL02431:Ptpn22 APN 3 103903397 missense probably benign 0.01
IGL02732:Ptpn22 APN 3 103886033 missense probably damaging 0.98
IGL02738:Ptpn22 APN 3 103874066 splice site probably benign
IGL03406:Ptpn22 APN 3 103912016 missense probably benign 0.14
R0490:Ptpn22 UTSW 3 103886179 missense probably damaging 1.00
R0494:Ptpn22 UTSW 3 103860455 missense probably damaging 1.00
R0626:Ptpn22 UTSW 3 103860405 start codon destroyed probably null 1.00
R0743:Ptpn22 UTSW 3 103902171 missense probably damaging 1.00
R1441:Ptpn22 UTSW 3 103874247 missense probably damaging 1.00
R1610:Ptpn22 UTSW 3 103902196 splice site probably null
R1698:Ptpn22 UTSW 3 103885798 missense probably benign 0.20
R1785:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1786:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1919:Ptpn22 UTSW 3 103876738 critical splice donor site probably null
R2045:Ptpn22 UTSW 3 103874021 missense possibly damaging 0.61
R3977:Ptpn22 UTSW 3 103873641 splice site probably benign
R4478:Ptpn22 UTSW 3 103902064 intron probably benign
R5093:Ptpn22 UTSW 3 103882102 missense probably benign 0.39
R5579:Ptpn22 UTSW 3 103882139 splice site probably null
R6022:Ptpn22 UTSW 3 103886105 missense probably benign 0.00
R6110:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R6387:Ptpn22 UTSW 3 103885386 missense probably benign 0.18
R7335:Ptpn22 UTSW 3 103886019 missense probably damaging 0.97
R7516:Ptpn22 UTSW 3 103885538 missense probably benign 0.16
R7523:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R7583:Ptpn22 UTSW 3 103902114 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TATTCACTGCCTGGTGCCTG -3'
(R):5'- TATGAGGCCTTCCTGTTGGC -3'

Sequencing Primer
(F):5'- ATGCGTCGTGTGTGCCC -3'
(R):5'- TGTTGGCACAGATGGGTCCC -3'
Posted On2015-06-10