Incidental Mutation 'R4176:Col11a1'
ID319501
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Namecollagen, type XI, alpha 1
SynonymsC530001D20Rik
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location114030540-114220718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114208223 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 432 (D432A)
Ref Sequence ENSEMBL: ENSMUSP00000138879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000184978]
Predicted Effect unknown
Transcript: ENSMUST00000092155
AA Change: D1572A
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: D1572A

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184978
AA Change: D432A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138879
Gene: ENSMUSG00000027966
AA Change: D432A

DomainStartEndE-ValueType
Pfam:Collagen 1 57 6.3e-10 PFAM
Pfam:Collagen 49 110 3.2e-10 PFAM
Pfam:Collagen 95 165 6.2e-8 PFAM
Pfam:Collagen 242 318 2.2e-9 PFAM
Pfam:Collagen 289 362 1.6e-7 PFAM
Pfam:Collagen 341 403 2e-9 PFAM
COLFI 434 536 8.88e-12 SMART
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 114066533 missense unknown
IGL00578:Col11a1 APN 3 114194106 missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 114124315 missense unknown
IGL01014:Col11a1 APN 3 114123809 splice site probably benign
IGL01099:Col11a1 APN 3 114112041 nonsense probably null
IGL01129:Col11a1 APN 3 114185873 splice site probably benign
IGL01474:Col11a1 APN 3 114217134 utr 3 prime probably benign
IGL01884:Col11a1 APN 3 114066542 missense unknown
IGL02104:Col11a1 APN 3 114181397 critical splice donor site probably null
IGL02715:Col11a1 APN 3 114129409 missense probably benign 0.06
IGL02978:Col11a1 APN 3 114061562 missense unknown
IGL03203:Col11a1 APN 3 114212084 missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114217210 splice site probably null
IGL03357:Col11a1 APN 3 114194091 missense probably damaging 1.00
IGL03390:Col11a1 APN 3 114090253 missense unknown
gluon UTSW 3 114217170 utr 3 prime probably benign
uncovered UTSW 3 114112467 unclassified probably benign
R0110:Col11a1 UTSW 3 114105456 splice site probably benign
R0144:Col11a1 UTSW 3 114113594 missense unknown
R0432:Col11a1 UTSW 3 114205901 splice site probably benign
R0468:Col11a1 UTSW 3 114217058 utr 3 prime probably benign
R0510:Col11a1 UTSW 3 114105456 splice site probably benign
R0535:Col11a1 UTSW 3 114061535 missense unknown
R0608:Col11a1 UTSW 3 114218715 utr 3 prime probably benign
R0826:Col11a1 UTSW 3 114138765 missense unknown
R0827:Col11a1 UTSW 3 114138765 missense unknown
R0862:Col11a1 UTSW 3 114138765 missense unknown
R0863:Col11a1 UTSW 3 114138765 missense unknown
R0926:Col11a1 UTSW 3 114090180 missense unknown
R0980:Col11a1 UTSW 3 114138765 missense unknown
R0981:Col11a1 UTSW 3 114138765 missense unknown
R1004:Col11a1 UTSW 3 114095022 splice site probably benign
R1037:Col11a1 UTSW 3 114194152 missense probably damaging 1.00
R1171:Col11a1 UTSW 3 114066564 missense unknown
R1316:Col11a1 UTSW 3 114138970 splice site probably null
R1324:Col11a1 UTSW 3 114030916 missense unknown
R1338:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1513:Col11a1 UTSW 3 114097154 missense unknown
R1528:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1567:Col11a1 UTSW 3 114138612 missense unknown
R1596:Col11a1 UTSW 3 114152613 utr 3 prime probably benign
R1605:Col11a1 UTSW 3 114131641 missense probably damaging 1.00
R1624:Col11a1 UTSW 3 114158155 missense probably damaging 0.97
R1626:Col11a1 UTSW 3 114131569 missense probably damaging 1.00
R1666:Col11a1 UTSW 3 114061535 missense unknown
R1806:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2001:Col11a1 UTSW 3 114165293 splice site probably null
R2084:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2085:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R3926:Col11a1 UTSW 3 114090124 splice site probably benign
R3950:Col11a1 UTSW 3 114121445 critical splice donor site probably null
R3970:Col11a1 UTSW 3 114097189 missense unknown
R4171:Col11a1 UTSW 3 114208214 missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 114108316 missense unknown
R4540:Col11a1 UTSW 3 114097166 missense unknown
R5210:Col11a1 UTSW 3 114153157 missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114217170 utr 3 prime probably benign
R5335:Col11a1 UTSW 3 114095240 missense unknown
R5344:Col11a1 UTSW 3 114208362 critical splice donor site probably null
R5394:Col11a1 UTSW 3 114194184 splice site probably null
R5687:Col11a1 UTSW 3 114217103 utr 3 prime probably benign
R5708:Col11a1 UTSW 3 114097094 missense unknown
R5763:Col11a1 UTSW 3 114094596 intron probably benign
R5792:Col11a1 UTSW 3 114131593 missense probably damaging 1.00
R6259:Col11a1 UTSW 3 114138447 missense probably benign
R6679:Col11a1 UTSW 3 114152719 splice site probably null
R6738:Col11a1 UTSW 3 114112467 unclassified probably benign
R6747:Col11a1 UTSW 3 114212450 nonsense probably null
R6808:Col11a1 UTSW 3 114094944 missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 114167492 missense probably damaging 1.00
R7201:Col11a1 UTSW 3 114090157 missense unknown
R7264:Col11a1 UTSW 3 114185599 missense unknown
R7393:Col11a1 UTSW 3 114097106 missense unknown
R7445:Col11a1 UTSW 3 114193929 missense unknown
R7479:Col11a1 UTSW 3 114102569 missense unknown
R7548:Col11a1 UTSW 3 114123760 missense unknown
R7683:Col11a1 UTSW 3 114113736 missense unknown
X0018:Col11a1 UTSW 3 114112233 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGAGTAACCTATGCAGTATGTCAC -3'
(R):5'- TGAGTGAACTGACAAGGCAC -3'

Sequencing Primer
(F):5'- CCTATGCAGTATGTCACCAAAATTTC -3'
(R):5'- CACTTTGGGGGCTGAACAG -3'
Posted On2015-06-10