Incidental Mutation 'R4176:Plekhn1'
ID319502
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Namepleckstrin homology domain containing, family N member 1
Synonyms
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156221456-156234857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156221801 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 604 (G604E)
Ref Sequence ENSEMBL: ENSMUSP00000151799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105571
AA Change: G605E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: G605E

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
AA Change: G604E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156222408 missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156223856 critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156223649 missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156224940 nonsense probably null
PIT4366001:Plekhn1 UTSW 4 156224811 missense probably damaging 0.99
R0123:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156228246 missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156228323 splice site probably benign
R0540:Plekhn1 UTSW 4 156222747 missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156225201 missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156225364 missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156228263 missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156223564 critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156222381 missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156221882 missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156222701 missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156222659 missense probably damaging 1.00
R3746:Plekhn1 UTSW 4 156225594 missense probably benign 0.00
R3818:Plekhn1 UTSW 4 156225533 missense probably damaging 1.00
R3902:Plekhn1 UTSW 4 156225669 missense possibly damaging 0.75
R4024:Plekhn1 UTSW 4 156224750 missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156224693 unclassified probably null
R4402:Plekhn1 UTSW 4 156225356 missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156225273 splice site probably null
R4477:Plekhn1 UTSW 4 156223399 missense probably damaging 1.00
R4515:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4517:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156222424 missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156224765 missense possibly damaging 0.93
R5201:Plekhn1 UTSW 4 156230527 missense probably benign 0.00
R5896:Plekhn1 UTSW 4 156223874 missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156222695 missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156225239 missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156230558 synonymous probably null
R6263:Plekhn1 UTSW 4 156225193 critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156221804 missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156224793 missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156224569 missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156221792 missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156233917 missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156223335 missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156222671 missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156233961 missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156230685 missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156233314 missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156224820 missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156225653 missense probably benign 0.00
R7738:Plekhn1 UTSW 4 156232234 missense probably damaging 1.00
R8065:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
R8067:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
X0023:Plekhn1 UTSW 4 156222354 missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156224915 critical splice donor site probably null
Z1176:Plekhn1 UTSW 4 156223431 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTGAGGTGCTTCTATCCTCAG -3'
(R):5'- ACTTGTACTTTGGGGCTTCC -3'

Sequencing Primer
(F):5'- GTGCTTCTATCCTCAGAGTCTAGAG -3'
(R):5'- GGCAAACCCAGTTCCCTG -3'
Posted On2015-06-10