Incidental Mutation 'R4176:Zfp141'
ID319508
Institutional Source Beutler Lab
Gene Symbol Zfp141
Ensembl Gene ENSMUSG00000092416
Gene Namezinc finger protein 141
Synonyms
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42473386-42505740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42476281 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 256 (S256T)
Ref Sequence ENSEMBL: ENSMUSP00000133899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173489] [ENSMUST00000174407]
Predicted Effect probably benign
Transcript: ENSMUST00000173489
Predicted Effect probably benign
Transcript: ENSMUST00000174407
AA Change: S256T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133899
Gene: ENSMUSG00000092416
AA Change: S256T

DomainStartEndE-ValueType
KRAB 18 78 4.41e-34 SMART
internal_repeat_1 146 405 8.73e-7 PROSPERO
ZnF_C2H2 410 432 4.54e-4 SMART
ZnF_C2H2 438 460 2.2e-2 SMART
ZnF_C2H2 466 488 2.95e-3 SMART
ZnF_C2H2 494 516 4.24e-4 SMART
ZnF_C2H2 522 544 9.58e-3 SMART
ZnF_C2H2 550 572 4.01e-5 SMART
ZnF_C2H2 578 600 3.21e-4 SMART
ZnF_C2H2 606 628 4.87e-4 SMART
ZnF_C2H2 634 656 5.99e-4 SMART
ZnF_C2H2 662 684 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174489
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in abnormal skin pigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Other mutations in Zfp141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp141 APN 7 42475307 nonsense probably null
IGL00595:Zfp141 APN 7 42476655 missense probably benign 0.08
R0577:Zfp141 UTSW 7 42476514 missense probably benign 0.14
R0883:Zfp141 UTSW 7 42476056 missense possibly damaging 0.85
R1701:Zfp141 UTSW 7 42476046 missense probably benign 0.35
R2290:Zfp141 UTSW 7 42475225 missense probably damaging 1.00
R4719:Zfp141 UTSW 7 42476687 splice site probably null
R4897:Zfp141 UTSW 7 42476205 missense probably benign 0.24
R5372:Zfp141 UTSW 7 42477196 missense possibly damaging 0.91
R5438:Zfp141 UTSW 7 42489470 missense probably damaging 1.00
R5447:Zfp141 UTSW 7 42475559 nonsense probably null
R5743:Zfp141 UTSW 7 42476431 missense possibly damaging 0.68
R5969:Zfp141 UTSW 7 42489488 missense probably damaging 0.98
R6731:Zfp141 UTSW 7 42489500 missense probably damaging 0.99
R7127:Zfp141 UTSW 7 42475429 missense probably damaging 1.00
R7474:Zfp141 UTSW 7 42476254 nonsense probably null
R7572:Zfp141 UTSW 7 42475432 missense probably benign 0.03
R7830:Zfp141 UTSW 7 42475188 missense probably benign 0.01
R7890:Zfp141 UTSW 7 42476479 missense probably damaging 0.99
R7973:Zfp141 UTSW 7 42476479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCAACAAGTTTCGAAGG -3'
(R):5'- AAGGTAACGACTCCTGGAATATC -3'

Sequencing Primer
(F):5'- AGTATGGCTTGAATCATTTTGAGTC -3'
(R):5'- CGACTCCTGGAATATCTATAAACAAG -3'
Posted On2015-06-10