Incidental Mutation 'R4176:Gabrb3'
ID319509
Institutional Source Beutler Lab
Gene Symbol Gabrb3
Ensembl Gene ENSMUSG00000033676
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 3
SynonymsA230092K12Rik, Gabrb-3, beta3
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location57419692-57828802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57591313 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 13 (F13S)
Ref Sequence ENSEMBL: ENSMUSP00000038051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039697] [ENSMUST00000085240] [ENSMUST00000138350] [ENSMUST00000196198]
Predicted Effect probably benign
Transcript: ENSMUST00000039697
AA Change: F13S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038051
Gene: ENSMUSG00000033676
AA Change: F13S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 1.3e-53 PFAM
Pfam:Neur_chan_memb 250 468 2.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085240
SMART Domains Protein: ENSMUSP00000082337
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 5.1e-51 PFAM
Pfam:Neur_chan_memb 250 468 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138350
SMART Domains Protein: ENSMUSP00000118835
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 123 2.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156375
Predicted Effect probably benign
Transcript: ENSMUST00000196198
SMART Domains Protein: ENSMUSP00000143353
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 9.7e-54 PFAM
Pfam:Neur_chan_memb 250 468 2e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ionic channel family. The encoded protein is one the subunits of a multi-subunit chloride channel that serves as the receptor for gamma-aminobutyric acid, a major inhibitory neurotransmitter of the mammalian nervous system. This gene is located on the long arm of chromosome 15 in a cluster with two other genes encoding related subunits of the family. This gene may be associated with the pathogenesis of several disorders including Angelman syndrome, Prader-Willi syndrome, nonsyndromic orofacial clefts, epilepsy and autism. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mutants die at birth with cleft palate. Survivors show delayed growth, reduced lifespan, seizures, ataxia, hyperactivity, hyperresponsiveness and reduced learning, mothering ability and REM sleep. A point mutation lowers anesthetic effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Gabrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Gabrb3 APN 7 57816478 missense probably benign 0.00
IGL01878:Gabrb3 APN 7 57816415 missense probably damaging 1.00
IGL02092:Gabrb3 APN 7 57765586 missense probably damaging 1.00
IGL02193:Gabrb3 APN 7 57792516 missense probably damaging 1.00
IGL02676:Gabrb3 APN 7 57591364 intron probably benign
R0325:Gabrb3 UTSW 7 57765530 missense probably damaging 1.00
R1560:Gabrb3 UTSW 7 57816295 missense probably damaging 0.98
R1562:Gabrb3 UTSW 7 57765514 nonsense probably null
R1714:Gabrb3 UTSW 7 57765428 missense probably damaging 1.00
R2054:Gabrb3 UTSW 7 57824493 missense probably benign 0.04
R4134:Gabrb3 UTSW 7 57591288 missense probably benign 0.01
R4135:Gabrb3 UTSW 7 57591288 missense probably benign 0.01
R4761:Gabrb3 UTSW 7 57765502 missense probably damaging 1.00
R4869:Gabrb3 UTSW 7 57792459 intron probably benign
R5247:Gabrb3 UTSW 7 57590591 missense possibly damaging 0.96
R6935:Gabrb3 UTSW 7 57591813 missense probably damaging 0.99
R7479:Gabrb3 UTSW 7 57824423 missense possibly damaging 0.74
R7562:Gabrb3 UTSW 7 57812178 nonsense probably null
R7692:Gabrb3 UTSW 7 57816455 missense probably damaging 1.00
X0064:Gabrb3 UTSW 7 57812185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCAAGCTCTGAGGACTTGG -3'
(R):5'- TCGTTTACGCTGAAGGAGG -3'

Sequencing Primer
(F):5'- TCTGAGGACTTGGCTCCG -3'
(R):5'- TTTACGCTGAAGGAGGGGCAC -3'
Posted On2015-06-10