Incidental Mutation 'R4176:Olfr372'
ID319513
Institutional Source Beutler Lab
Gene Symbol Olfr372
Ensembl Gene ENSMUSG00000069998
Gene Nameolfactory receptor 372
SynonymsGA_x6K02T2NUPS-191522-192466, MOR282-1
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72041218-72060630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72058184 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 168 (Y168C)
Ref Sequence ENSEMBL: ENSMUSP00000149288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093434] [ENSMUST00000215324]
Predicted Effect probably damaging
Transcript: ENSMUST00000093434
AA Change: Y168C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132724
Gene: ENSMUSG00000069998
AA Change: Y168C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 221 1.1e-7 PFAM
Pfam:7tm_1 41 290 6.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215324
AA Change: Y168C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Olfr372
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03251:Olfr372 APN 8 72058076 missense probably damaging 1.00
R0126:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0128:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0130:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0132:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0152:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0230:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0244:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0256:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0257:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0294:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0316:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0318:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0391:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0479:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0604:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0624:Olfr372 UTSW 8 72058162 missense possibly damaging 0.94
R0631:Olfr372 UTSW 8 72058322 missense probably damaging 0.99
R1785:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R1786:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R2040:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
R4782:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R4799:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R6915:Olfr372 UTSW 8 72057730 missense probably benign 0.19
R7512:Olfr372 UTSW 8 72058523 missense probably damaging 1.00
R8255:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
RF022:Olfr372 UTSW 8 72058624 makesense probably null
Predicted Primers PCR Primer
(F):5'- CTCATGCTCATGGGTGTCTC -3'
(R):5'- AAGCCTTGTGTCTAGCTTCAG -3'

Sequencing Primer
(F):5'- CTGAGGGTGTCCTTCTGTCC -3'
(R):5'- TGACCGCATGTGCAGTACAG -3'
Posted On2015-06-10