Incidental Mutation 'R4176:Usp38'
ID319514
Institutional Source Beutler Lab
Gene Symbol Usp38
Ensembl Gene ENSMUSG00000038250
Gene Nameubiquitin specific peptidase 38
Synonyms4833420O05Rik, 4631402N15Rik
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80980733-81014928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80993299 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 434 (S434A)
Ref Sequence ENSEMBL: ENSMUSP00000039943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042724]
Predicted Effect probably benign
Transcript: ENSMUST00000042724
AA Change: S434A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039943
Gene: ENSMUSG00000038250
AA Change: S434A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 1 365 5e-3 SMART
Pfam:UCH 444 946 1.8e-47 PFAM
Pfam:UCH_1 445 921 2.2e-23 PFAM
low complexity region 995 1006 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211538
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Usp38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Usp38 APN 8 81013840 missense probably damaging 0.99
IGL01373:Usp38 APN 8 80990018 missense possibly damaging 0.80
IGL02089:Usp38 APN 8 80985714 missense possibly damaging 0.48
IGL02528:Usp38 APN 8 80993235 missense probably damaging 1.00
IGL02538:Usp38 APN 8 80985558 missense probably damaging 1.00
IGL02615:Usp38 APN 8 80985151 missense probably benign 0.00
IGL03340:Usp38 APN 8 81012276 missense probably damaging 1.00
P0033:Usp38 UTSW 8 80981896 missense probably benign 0.12
R0313:Usp38 UTSW 8 80984442 nonsense probably null
R0331:Usp38 UTSW 8 80995840 missense probably benign 0.00
R0497:Usp38 UTSW 8 80984424 splice site probably benign
R0594:Usp38 UTSW 8 81005366 missense probably damaging 0.97
R0632:Usp38 UTSW 8 81014150 missense probably benign 0.03
R1355:Usp38 UTSW 8 80985033 missense possibly damaging 0.61
R1500:Usp38 UTSW 8 80995770 missense probably damaging 1.00
R1566:Usp38 UTSW 8 80984803 missense probably benign 0.00
R1880:Usp38 UTSW 8 81001066 missense probably damaging 1.00
R4161:Usp38 UTSW 8 80993338 missense probably damaging 1.00
R4882:Usp38 UTSW 8 80981977 nonsense probably null
R5344:Usp38 UTSW 8 80985763 missense possibly damaging 0.76
R5481:Usp38 UTSW 8 80993323 missense possibly damaging 0.89
R5564:Usp38 UTSW 8 80985088 missense probably damaging 0.96
R5897:Usp38 UTSW 8 81005453 missense probably benign 0.03
R6111:Usp38 UTSW 8 81013922 missense probably damaging 1.00
R6746:Usp38 UTSW 8 81014291 missense possibly damaging 0.80
R6912:Usp38 UTSW 8 80993329 missense probably damaging 1.00
R7051:Usp38 UTSW 8 81001121 missense possibly damaging 0.50
R7483:Usp38 UTSW 8 81014561 start gained probably benign
R7525:Usp38 UTSW 8 81014246 missense probably damaging 1.00
R7565:Usp38 UTSW 8 80981972 missense probably damaging 1.00
RF016:Usp38 UTSW 8 81013893 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTACGCTGCTTACACGG -3'
(R):5'- TCAAATGTCAGTAGGGAAGTCC -3'

Sequencing Primer
(F):5'- AGCAGGGACGATTCTCTCCTC -3'
(R):5'- CTTTCCTAAGCCCAGTGA -3'
Posted On2015-06-10