Incidental Mutation 'R4176:Elp5'
ID319520
Institutional Source Beutler Lab
Gene Symbol Elp5
Ensembl Gene ENSMUSG00000018565
Gene Nameelongator acetyltransferase complex subunit 5
SynonymsRai12, Clone 13u
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69968222-69982517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69970562 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 197 (Q197R)
Ref Sequence ENSEMBL: ENSMUSP00000104235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018713] [ENSMUST00000060651] [ENSMUST00000108594] [ENSMUST00000108595] [ENSMUST00000108596] [ENSMUST00000108597] [ENSMUST00000142788] [ENSMUST00000147437] [ENSMUST00000151515]
Predicted Effect probably benign
Transcript: ENSMUST00000018713
SMART Domains Protein: ENSMUSP00000018713
Gene: ENSMUSG00000018569

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2.3e-53 PFAM
Pfam:Claudin_2 15 184 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060651
SMART Domains Protein: ENSMUSP00000090725
Gene: ENSMUSG00000018569

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 83 3.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108594
AA Change: Q197R

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104235
Gene: ENSMUSG00000018565
AA Change: Q197R

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 201 1.1e-12 PFAM
Pfam:Elong_Iki1 205 282 3.8e-10 PFAM
low complexity region 283 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108595
SMART Domains Protein: ENSMUSP00000104236
Gene: ENSMUSG00000018565

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 139 9.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108596
SMART Domains Protein: ENSMUSP00000104237
Gene: ENSMUSG00000018569

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 99 1.1e-29 PFAM
Pfam:Claudin_2 1 101 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108597
SMART Domains Protein: ENSMUSP00000104238
Gene: ENSMUSG00000018569

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2.5e-53 PFAM
Pfam:Claudin_2 15 184 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123701
Predicted Effect probably benign
Transcript: ENSMUST00000127437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138562
Predicted Effect probably benign
Transcript: ENSMUST00000142788
SMART Domains Protein: ENSMUSP00000136063
Gene: ENSMUSG00000018565

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 63 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143788
Predicted Effect probably benign
Transcript: ENSMUST00000147437
SMART Domains Protein: ENSMUSP00000117394
Gene: ENSMUSG00000018565

DomainStartEndE-ValueType
Pfam:Elong_Iki1 1 115 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151515
SMART Domains Protein: ENSMUSP00000137627
Gene: ENSMUSG00000018569

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 99 5.7e-30 PFAM
Pfam:Claudin_2 1 101 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151766
Meta Mutation Damage Score 0.6256 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Elp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Elp5 APN 11 69968422 unclassified probably benign
IGL01295:Elp5 APN 11 69968470 unclassified probably benign
IGL01405:Elp5 APN 11 69969136 missense probably damaging 0.97
PIT1430001:Elp5 UTSW 11 69967109 critical splice donor site probably null
R0367:Elp5 UTSW 11 69975141 missense probably benign 0.01
R1376:Elp5 UTSW 11 69975090 missense probably benign 0.00
R1376:Elp5 UTSW 11 69975090 missense probably benign 0.00
R2392:Elp5 UTSW 11 69975102 missense probably benign 0.01
R4175:Elp5 UTSW 11 69970562 missense probably null 0.90
R4650:Elp5 UTSW 11 69969572 missense possibly damaging 0.69
R4988:Elp5 UTSW 11 69979842 missense probably benign 0.03
R7695:Elp5 UTSW 11 69969501 missense probably benign 0.10
R7878:Elp5 UTSW 11 69970599 missense probably damaging 0.98
R7961:Elp5 UTSW 11 69970599 missense probably damaging 0.98
X0024:Elp5 UTSW 11 69970599 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATCCCATTATGCTGCCTGC -3'
(R):5'- AACTCCCTAGTAGAGCAGGTGC -3'

Sequencing Primer
(F):5'- TTTCGGAAAGGCCTCCCTAAG -3'
(R):5'- CGTGTCCTGGGCCTCCTAC -3'
Posted On2015-06-10