Incidental Mutation 'R4176:Pelp1'
ID319521
Institutional Source Beutler Lab
Gene Symbol Pelp1
Ensembl Gene ENSMUSG00000018921
Gene Nameproline, glutamic acid and leucine rich protein 1
SynonymsMNAR, 4930563C04Rik
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70392883-70410031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70396867 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 410 (W410R)
Ref Sequence ENSEMBL: ENSMUSP00000019065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019065]
Predicted Effect probably damaging
Transcript: ENSMUST00000019065
AA Change: W410R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019065
Gene: ENSMUSG00000018921
AA Change: W410R

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:RIX1 63 232 7.5e-30 PFAM
low complexity region 264 278 N/A INTRINSIC
low complexity region 359 386 N/A INTRINSIC
Pfam:NUC202 424 490 8.6e-30 PFAM
Pfam:NUC202 570 644 6e-19 PFAM
low complexity region 748 758 N/A INTRINSIC
low complexity region 797 830 N/A INTRINSIC
low complexity region 834 863 N/A INTRINSIC
low complexity region 869 877 N/A INTRINSIC
SCOP:d1sig__ 892 958 9e-6 SMART
low complexity region 974 989 N/A INTRINSIC
low complexity region 993 1021 N/A INTRINSIC
low complexity region 1070 1090 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which coactivates transcription of estrogen receptor responsive genes and corepresses genes activated by other hormone receptors or sequence-specific transcription factors. Expression of this gene is regulated by both members of the estrogen receptor family. This gene may be involved in the progression of several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Pelp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Pelp1 APN 11 70394812 missense possibly damaging 0.88
IGL00819:Pelp1 APN 11 70394618 missense unknown
IGL01017:Pelp1 APN 11 70396894 missense probably damaging 1.00
IGL01347:Pelp1 APN 11 70395679 missense probably damaging 1.00
IGL01460:Pelp1 APN 11 70393964 missense unknown
IGL02022:Pelp1 APN 11 70406327 splice site probably benign
IGL02188:Pelp1 APN 11 70409892 missense unknown
ANU74:Pelp1 UTSW 11 70395087 missense probably damaging 0.97
F5770:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
R0056:Pelp1 UTSW 11 70393832 missense unknown
R0201:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0637:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0879:Pelp1 UTSW 11 70395297 splice site probably benign
R1073:Pelp1 UTSW 11 70396590 missense probably damaging 1.00
R1858:Pelp1 UTSW 11 70394742 missense probably damaging 0.99
R1937:Pelp1 UTSW 11 70393715 intron probably null
R1958:Pelp1 UTSW 11 70398521 missense probably damaging 0.99
R3613:Pelp1 UTSW 11 70395435 missense probably benign 0.01
R3722:Pelp1 UTSW 11 70398200 missense possibly damaging 0.62
R5137:Pelp1 UTSW 11 70395099 missense probably damaging 0.98
R5253:Pelp1 UTSW 11 70401661 missense probably damaging 1.00
R5616:Pelp1 UTSW 11 70394862 missense possibly damaging 0.73
R5911:Pelp1 UTSW 11 70396914 missense probably damaging 0.99
R5938:Pelp1 UTSW 11 70394867 missense probably damaging 0.98
R6461:Pelp1 UTSW 11 70396306 missense probably damaging 1.00
R7387:Pelp1 UTSW 11 70396599 missense probably damaging 0.99
R7625:Pelp1 UTSW 11 70395434 missense probably benign 0.03
R7694:Pelp1 UTSW 11 70394759 missense probably damaging 0.99
R7873:Pelp1 UTSW 11 70394726 missense probably damaging 1.00
R7956:Pelp1 UTSW 11 70394726 missense probably damaging 1.00
V7580:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7581:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7582:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7583:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
Z1088:Pelp1 UTSW 11 70396890 missense probably damaging 1.00
Z1177:Pelp1 UTSW 11 70397094 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCGAATGGTGCTGGAGAAG -3'
(R):5'- TCCAGAACTTGCTTGGAGATGG -3'

Sequencing Primer
(F):5'- CGAATGGTGCTGGAGAAGGAATAAG -3'
(R):5'- AACTTGCTTGGAGATGGTCCCC -3'
Posted On2015-06-10