Incidental Mutation 'R4176:Ankrd12'
ID319531
Institutional Source Beutler Lab
Gene Symbol Ankrd12
Ensembl Gene ENSMUSG00000034647
Gene Nameankyrin repeat domain 12
Synonyms2900001A12Rik, GAC-1, ANCO-2
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65967501-66077089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66027366 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 204 (N204K)
Ref Sequence ENSEMBL: ENSMUSP00000114237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038116] [ENSMUST00000150766]
Predicted Effect probably damaging
Transcript: ENSMUST00000038116
AA Change: N227K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039035
Gene: ENSMUSG00000034647
AA Change: N227K

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
ANK 184 213 8.78e-6 SMART
ANK 217 246 1.76e-5 SMART
ANK 250 279 7.64e-6 SMART
low complexity region 292 300 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
coiled coil region 459 497 N/A INTRINSIC
coiled coil region 639 676 N/A INTRINSIC
coiled coil region 725 752 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 999 1018 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
low complexity region 1182 1197 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143516
Predicted Effect probably damaging
Transcript: ENSMUST00000150766
AA Change: N204K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114237
Gene: ENSMUSG00000034647
AA Change: N204K

DomainStartEndE-ValueType
low complexity region 78 98 N/A INTRINSIC
ANK 161 190 8.78e-6 SMART
ANK 194 223 1.76e-5 SMART
ANK 227 256 7.64e-6 SMART
low complexity region 269 277 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Ankrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ankrd12 APN 17 65986174 missense probably benign
IGL00555:Ankrd12 APN 17 65984976 missense probably benign 0.09
IGL00790:Ankrd12 APN 17 65984180 missense probably benign
IGL00808:Ankrd12 APN 17 65983965 missense probably benign 0.03
IGL01355:Ankrd12 APN 17 65970340 splice site probably benign
IGL01707:Ankrd12 APN 17 65984278 missense probably damaging 0.98
IGL02045:Ankrd12 APN 17 65986249 missense probably benign 0.17
IGL02125:Ankrd12 APN 17 65970144 utr 3 prime probably benign
IGL02292:Ankrd12 APN 17 66042587 missense probably damaging 0.99
IGL02376:Ankrd12 APN 17 66042529 intron probably benign
IGL02435:Ankrd12 APN 17 65987156 missense probably damaging 1.00
IGL02530:Ankrd12 APN 17 65984403 missense probably benign 0.20
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0094:Ankrd12 UTSW 17 65970176 missense probably damaging 1.00
R0195:Ankrd12 UTSW 17 66049948 splice site probably null
R0227:Ankrd12 UTSW 17 65987227 missense probably benign 0.00
R0363:Ankrd12 UTSW 17 65985681 missense probably damaging 1.00
R0366:Ankrd12 UTSW 17 65984506 missense possibly damaging 0.93
R0376:Ankrd12 UTSW 17 66053009 missense probably damaging 0.98
R0470:Ankrd12 UTSW 17 65986134 missense probably benign 0.00
R0480:Ankrd12 UTSW 17 66049828 missense possibly damaging 0.47
R0538:Ankrd12 UTSW 17 66049852 missense probably damaging 1.00
R0883:Ankrd12 UTSW 17 65985132 missense probably benign 0.19
R1181:Ankrd12 UTSW 17 66042574 missense probably benign 0.36
R1386:Ankrd12 UTSW 17 65983380 missense possibly damaging 0.94
R1476:Ankrd12 UTSW 17 65986305 missense probably damaging 0.99
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1602:Ankrd12 UTSW 17 65983688 nonsense probably null
R1728:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1729:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1784:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1795:Ankrd12 UTSW 17 65986227 missense possibly damaging 0.89
R1901:Ankrd12 UTSW 17 65986703 missense possibly damaging 0.58
R1929:Ankrd12 UTSW 17 65986686 missense possibly damaging 0.55
R1952:Ankrd12 UTSW 17 66031571 missense probably damaging 0.98
R1997:Ankrd12 UTSW 17 65984884 missense probably damaging 1.00
R2207:Ankrd12 UTSW 17 66031574 splice site probably null
R3612:Ankrd12 UTSW 17 65983547 missense probably benign 0.01
R3768:Ankrd12 UTSW 17 65985720 missense probably benign
R3909:Ankrd12 UTSW 17 65984005 missense probably benign 0.05
R3945:Ankrd12 UTSW 17 65976103 missense probably damaging 1.00
R4461:Ankrd12 UTSW 17 65985937 unclassified probably null
R4628:Ankrd12 UTSW 17 65985994 missense probably benign
R4726:Ankrd12 UTSW 17 65970324 missense probably damaging 1.00
R4785:Ankrd12 UTSW 17 65982999 missense probably damaging 1.00
R4828:Ankrd12 UTSW 17 65984637 missense probably damaging 0.99
R4847:Ankrd12 UTSW 17 66024092 missense probably benign 0.14
R4858:Ankrd12 UTSW 17 66031433 missense probably damaging 1.00
R5344:Ankrd12 UTSW 17 66049848 missense probably damaging 1.00
R5749:Ankrd12 UTSW 17 65986096 missense probably benign 0.02
R7132:Ankrd12 UTSW 17 65983247 missense probably benign
R7205:Ankrd12 UTSW 17 65985165 missense probably damaging 1.00
R7379:Ankrd12 UTSW 17 65985247 nonsense probably null
R7569:Ankrd12 UTSW 17 65982905 missense probably damaging 1.00
R7570:Ankrd12 UTSW 17 65985360 missense probably benign
R7783:Ankrd12 UTSW 17 66027250 critical splice donor site probably null
R7790:Ankrd12 UTSW 17 65984230 missense possibly damaging 0.71
R7808:Ankrd12 UTSW 17 65985653 missense possibly damaging 0.94
R7834:Ankrd12 UTSW 17 65987352 missense probably damaging 1.00
R7896:Ankrd12 UTSW 17 65985685 nonsense probably null
R7917:Ankrd12 UTSW 17 65987352 missense probably damaging 1.00
R7979:Ankrd12 UTSW 17 65985685 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAAGTGTGAGCCCTGAC -3'
(R):5'- TTTAGCTGACTCCTAACCAAGTC -3'

Sequencing Primer
(F):5'- TGTGAGCCCTGACACAAGCAG -3'
(R):5'- GGCACCAGATCTCATTATGGATG -3'
Posted On2015-06-10