Incidental Mutation 'R4176:Dagla'
ID319535
Institutional Source Beutler Lab
Gene Symbol Dagla
Ensembl Gene ENSMUSG00000035735
Gene Namediacylglycerol lipase, alpha
SynonymsNsddr
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10245265-10304877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10263097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 256 (D256E)
Ref Sequence ENSEMBL: ENSMUSP00000046358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039327] [ENSMUST00000125567]
Predicted Effect probably damaging
Transcript: ENSMUST00000039327
AA Change: D256E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046358
Gene: ENSMUSG00000035735
AA Change: D256E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
Pfam:Lipase_3 394 533 1.3e-12 PFAM
low complexity region 616 625 N/A INTRINSIC
low complexity region 699 717 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
low complexity region 980 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125567
SMART Domains Protein: ENSMUSP00000138702
Gene: ENSMUSG00000035735

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a diacylglycerol lipase. The encoded enzyme is involved in the biosynthesis of the endocannabinoid 2-arachidonoyl-glycerol.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for null mutations have decreased body weight, adult neuronal proliferation, and nervous system endocannaboid levels and abnormal inhibitory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Dagla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Dagla APN 19 10248520 missense possibly damaging 0.51
IGL01625:Dagla APN 19 10251202 splice site probably benign
IGL01697:Dagla APN 19 10271198 missense probably benign 0.01
IGL01940:Dagla APN 19 10252171 missense probably benign
IGL02330:Dagla APN 19 10248022 missense probably damaging 1.00
PIT4480001:Dagla UTSW 19 10260658 missense probably benign 0.02
R0541:Dagla UTSW 19 10254806 critical splice donor site probably null
R0610:Dagla UTSW 19 10271558 missense probably damaging 1.00
R0638:Dagla UTSW 19 10254883 missense probably damaging 0.97
R0653:Dagla UTSW 19 10248425 missense probably damaging 1.00
R1675:Dagla UTSW 19 10269323 missense probably benign 0.00
R1822:Dagla UTSW 19 10263186 missense possibly damaging 0.94
R1830:Dagla UTSW 19 10271014 missense probably benign 0.44
R2303:Dagla UTSW 19 10252103 missense probably damaging 1.00
R2568:Dagla UTSW 19 10248152 missense probably benign
R2879:Dagla UTSW 19 10271084 missense possibly damaging 0.93
R2902:Dagla UTSW 19 10248103 missense probably damaging 0.99
R2939:Dagla UTSW 19 10256364 missense probably damaging 1.00
R3771:Dagla UTSW 19 10248467 missense possibly damaging 0.89
R4255:Dagla UTSW 19 10256952 nonsense probably null
R4519:Dagla UTSW 19 10269732 missense probably damaging 1.00
R4584:Dagla UTSW 19 10271009 missense probably damaging 1.00
R4586:Dagla UTSW 19 10271009 missense probably damaging 1.00
R4614:Dagla UTSW 19 10248277 missense probably damaging 1.00
R4751:Dagla UTSW 19 10250394 missense probably benign 0.00
R4933:Dagla UTSW 19 10269715 critical splice donor site probably null
R5844:Dagla UTSW 19 10271125 missense probably damaging 1.00
R5858:Dagla UTSW 19 10254968 intron probably benign
R5958:Dagla UTSW 19 10248424 missense probably damaging 1.00
R6628:Dagla UTSW 19 10263227 missense probably damaging 1.00
R6799:Dagla UTSW 19 10256850 missense probably damaging 1.00
R7072:Dagla UTSW 19 10256295 critical splice donor site probably null
R7253:Dagla UTSW 19 10262581 splice site probably null
R7451:Dagla UTSW 19 10253355 missense probably damaging 1.00
R7654:Dagla UTSW 19 10248206 missense probably benign 0.01
X0021:Dagla UTSW 19 10271164 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACGGGACATCCTCAGAG -3'
(R):5'- CCAGAATTGTAGCGATTTCCGG -3'

Sequencing Primer
(F):5'- ACATCCTCAGAGGCTGGC -3'
(R):5'- GCCCTTGGTGTTCACTCATGG -3'
Posted On2015-06-10