Incidental Mutation 'R4177:Olfr1095'
ID319542
Institutional Source Beutler Lab
Gene Symbol Olfr1095
Ensembl Gene ENSMUSG00000075171
Gene Nameolfactory receptor 1095
SynonymsGA_x6K02T2Q125-48336843-48335917, MOR179-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4177 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86850770-86851696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86851401 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 99 (M99K)
Ref Sequence ENSEMBL: ENSMUSP00000097459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099874
AA Change: M99K

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097459
Gene: ENSMUSG00000075171
AA Change: M99K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-47 PFAM
Pfam:7tm_1 39 288 9.8e-21 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aicda A T 6: 122,561,084 D67V probably benign Het
Arhgap32 A G 9: 32,247,214 R182G probably null Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
Bscl2 A G 19: 8,839,756 D16G possibly damaging Het
Celsr2 A G 3: 108,413,978 V506A probably damaging Het
Cenpf T A 1: 189,668,619 Q441L possibly damaging Het
Crebbp A T 16: 4,119,799 M700K possibly damaging Het
Dhcr7 A G 7: 143,841,173 Y142C probably damaging Het
Dnajc2 A G 5: 21,757,396 M602T probably benign Het
Dysf C T 6: 84,067,031 R254* probably null Het
Ednra A C 8: 77,675,048 I204M possibly damaging Het
Fabp2 A G 3: 122,896,898 T77A possibly damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Gm13212 T C 4: 145,620,655 L43S probably damaging Het
Gnb1 T C 4: 155,540,656 probably benign Het
Gpc2 T C 5: 138,277,359 probably benign Het
Kmt2a T C 9: 44,820,983 probably benign Het
Lypla2 T C 4: 135,969,092 probably benign Het
Maf A T 8: 115,706,471 Y131* probably null Het
Mfsd4a T A 1: 132,040,557 H335L probably damaging Het
Mrgpra9 A G 7: 47,235,554 Y122H probably damaging Het
Myo10 A T 15: 25,734,051 Q342L possibly damaging Het
N4bp2 A G 5: 65,798,170 probably null Het
Pomt1 A G 2: 32,248,677 N435S probably damaging Het
Pram1 A G 17: 33,641,229 I257V probably benign Het
Rab9 G T X: 166,458,300 S5* probably null Het
Ralgapa2 A T 2: 146,485,163 Y59N probably damaging Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Rps6kc1 G A 1: 190,800,419 T462M possibly damaging Het
Selenoo C T 15: 89,099,459 probably benign Het
Sptb G C 12: 76,613,179 D982E probably benign Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubald1 A G 16: 4,875,881 probably benign Het
Ube2d1 T C 10: 71,258,203 K101R probably damaging Het
Unc5cl A G 17: 48,462,270 T261A probably benign Het
Zcwpw1 G T 5: 137,800,133 K197N probably damaging Het
Zfyve19 A G 2: 119,216,212 T296A possibly damaging Het
Other mutations in Olfr1095
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:Olfr1095 APN 2 86851197 missense possibly damaging 0.77
IGL02947:Olfr1095 APN 2 86850786 missense probably benign 0.00
IGL03106:Olfr1095 APN 2 86851614 missense possibly damaging 0.92
R0631:Olfr1095 UTSW 2 86850967 missense probably benign 0.07
R1640:Olfr1095 UTSW 2 86851227 missense probably benign 0.05
R1718:Olfr1095 UTSW 2 86851187 missense probably benign 0.22
R1936:Olfr1095 UTSW 2 86851401 missense probably benign 0.01
R3720:Olfr1095 UTSW 2 86851591 missense probably benign 0.16
R5378:Olfr1095 UTSW 2 86851463 missense probably benign
R5589:Olfr1095 UTSW 2 86850774 missense unknown
R6158:Olfr1095 UTSW 2 86851515 missense possibly damaging 0.92
R6326:Olfr1095 UTSW 2 86850994 missense probably benign 0.00
R6637:Olfr1095 UTSW 2 86851440 missense probably benign 0.01
Z1176:Olfr1095 UTSW 2 86850940 missense
Predicted Primers PCR Primer
(F):5'- TGAAAGTGGCCACTGTGTG -3'
(R):5'- TTGTTCTCAAGGGACTCACAG -3'

Sequencing Primer
(F):5'- CACTGTGTGGATAATAGCATGC -3'
(R):5'- TGTTCTCAAGGGACTCACAGACAAC -3'
Posted On2015-06-10