Mutagenetix > Incidental Mutations

Incidental Mutation 'R4177:Ralgapa2'

319544

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa2

Ensembl Gene

ENSMUSG00000037110

Gene Name

Ral GTPase activating protein, alpha subunit 2 (catalytic)

Synonyms

AS250, RGC2, A230067G21Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R4177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

146239879-146512344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146485163 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 59 (Y59N)

Ref Sequence

ENSEMBL: ENSMUSP00000153734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000109982

Predicted Effect

probably damaging
Transcript: ENSMUST00000109986
AA Change: Y59N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: Y59N

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	1017	1028	N/A	INTRINSIC
low complexity region	1296	1301	N/A	INTRINSIC
Pfam:Rap_GAP	1701	1877	6.8e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124709

Predicted Effect

probably damaging
Transcript: ENSMUST00000131824
AA Change: Y59N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: Y59N

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	979	990	N/A	INTRINSIC
low complexity region	1258	1263	N/A	INTRINSIC
Pfam:Rap_GAP	1663	1842	1.3e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135974

Predicted Effect

probably damaging
Transcript: ENSMUST00000228797
AA Change: Y59N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2142

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (46/46)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aicda	A	T	6: 122,561,084	D67V	probably benign	Het
Arhgap32	A	G	9: 32,247,214	R182G	probably null	Het
Bbx	T	C	16: 50,224,858	K447E	probably damaging	Het
Bscl2	A	G	19: 8,839,756	D16G	possibly damaging	Het
Celsr2	A	G	3: 108,413,978	V506A	probably damaging	Het
Cenpf	T	A	1: 189,668,619	Q441L	possibly damaging	Het
Crebbp	A	T	16: 4,119,799	M700K	possibly damaging	Het
Dhcr7	A	G	7: 143,841,173	Y142C	probably damaging	Het
Dnajc2	A	G	5: 21,757,396	M602T	probably benign	Het
Dysf	C	T	6: 84,067,031	R254*	probably null	Het
Ednra	A	C	8: 77,675,048	I204M	possibly damaging	Het
Fabp2	A	G	3: 122,896,898	T77A	possibly damaging	Het
Gm10322	C	A	10: 59,616,230	N56K	probably benign	Het
Gm13212	T	C	4: 145,620,655	L43S	probably damaging	Het
Gnb1	T	C	4: 155,540,656		probably benign	Het
Gpc2	T	C	5: 138,277,359		probably benign	Het
Kmt2a	T	C	9: 44,820,983		probably benign	Het
Lypla2	T	C	4: 135,969,092		probably benign	Het
Maf	A	T	8: 115,706,471	Y131*	probably null	Het
Mfsd4a	T	A	1: 132,040,557	H335L	probably damaging	Het
Mrgpra9	A	G	7: 47,235,554	Y122H	probably damaging	Het
Myo10	A	T	15: 25,734,051	Q342L	possibly damaging	Het
N4bp2	A	G	5: 65,798,170		probably null	Het
Olfr1095	A	T	2: 86,851,401	M99K	possibly damaging	Het
Pomt1	A	G	2: 32,248,677	N435S	probably damaging	Het
Pram1	A	G	17: 33,641,229	I257V	probably benign	Het
Rab9	G	T	X: 166,458,300	S5*	probably null	Het
Rasgrf2	C	T	13: 91,890,598	G1043D	probably damaging	Het
Rps6kc1	G	A	1: 190,800,419	T462M	possibly damaging	Het
Selenoo	C	T	15: 89,099,459		probably benign	Het
Sptb	G	C	12: 76,613,179	D982E	probably benign	Het
Tab2	A	G	10: 7,919,359	V453A	probably damaging	Het
Ubald1	A	G	16: 4,875,881		probably benign	Het
Ube2d1	T	C	10: 71,258,203	K101R	probably damaging	Het
Unc5cl	A	G	17: 48,462,270	T261A	probably benign	Het
Zcwpw1	G	T	5: 137,800,133	K197N	probably damaging	Het
Zfyve19	A	G	2: 119,216,212	T296A	possibly damaging	Het

Other mutations in Ralgapa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Ralgapa2	APN	2	146485136	missense	possibly damaging	0.61
IGL00915:Ralgapa2	APN	2	146342522	missense	probably damaging	1.00
IGL01012:Ralgapa2	APN	2	146421739	missense	possibly damaging	0.95
IGL01018:Ralgapa2	APN	2	146410193	missense	probably benign	0.02
IGL01018:Ralgapa2	APN	2	146410192	missense	probably benign	0.00
IGL01902:Ralgapa2	APN	2	146315014	missense	probably damaging	1.00
IGL02160:Ralgapa2	APN	2	146348440	splice site	probably benign
IGL02321:Ralgapa2	APN	2	146412816	nonsense	probably null
IGL02412:Ralgapa2	APN	2	146412132	missense	probably damaging	0.96
IGL03026:Ralgapa2	APN	2	146460775	splice site	probably benign
IGL03115:Ralgapa2	APN	2	146424814	missense	probably damaging	0.99
IGL03256:Ralgapa2	APN	2	146460712	critical splice donor site	probably null
IGL03379:Ralgapa2	APN	2	146357987	missense	probably benign	0.01
P4748:Ralgapa2	UTSW	2	146346811	nonsense	probably null
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0165:Ralgapa2	UTSW	2	146388487	splice site	probably benign
R0344:Ralgapa2	UTSW	2	146346794	missense	possibly damaging	0.69
R0402:Ralgapa2	UTSW	2	146434809	missense	probably damaging	0.98
R0419:Ralgapa2	UTSW	2	146428672	missense	possibly damaging	0.69
R0638:Ralgapa2	UTSW	2	146342192	missense	probably benign	0.00
R0704:Ralgapa2	UTSW	2	146451784	missense	probably damaging	1.00
R0722:Ralgapa2	UTSW	2	146388531	missense	probably damaging	1.00
R0866:Ralgapa2	UTSW	2	146436003	missense	probably damaging	1.00
R1065:Ralgapa2	UTSW	2	146450558	missense	probably benign	0.00
R1212:Ralgapa2	UTSW	2	146357982	missense	probably benign	0.00
R1395:Ralgapa2	UTSW	2	146388500	missense	probably damaging	1.00
R1614:Ralgapa2	UTSW	2	146388612	missense	probably damaging	1.00
R1686:Ralgapa2	UTSW	2	146358000	missense	probably benign	0.09
R1799:Ralgapa2	UTSW	2	146342728	missense	probably benign	0.02
R1905:Ralgapa2	UTSW	2	146387701	missense	probably damaging	1.00
R1956:Ralgapa2	UTSW	2	146460759	missense	probably benign	0.00
R2144:Ralgapa2	UTSW	2	146388604	missense	probably damaging	1.00
R2148:Ralgapa2	UTSW	2	146431887	missense	probably benign	0.02
R2219:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2220:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2261:Ralgapa2	UTSW	2	146342683	missense	probably damaging	1.00
R2402:Ralgapa2	UTSW	2	146353192	missense	probably damaging	1.00
R2495:Ralgapa2	UTSW	2	146361400	missense	possibly damaging	0.82
R3752:Ralgapa2	UTSW	2	146421631	missense	possibly damaging	0.94
R3953:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R3956:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R4182:Ralgapa2	UTSW	2	146435994	missense	probably damaging	1.00
R4193:Ralgapa2	UTSW	2	146342573	missense	probably damaging	1.00
R4332:Ralgapa2	UTSW	2	146260368	missense	probably benign	0.10
R4507:Ralgapa2	UTSW	2	146353248	missense	probably benign	0.11
R4574:Ralgapa2	UTSW	2	146435999	missense	probably damaging	1.00
R4585:Ralgapa2	UTSW	2	146315024	missense	probably damaging	0.99
R4627:Ralgapa2	UTSW	2	146361453	missense	possibly damaging	0.88
R4647:Ralgapa2	UTSW	2	146387629	missense	possibly damaging	0.69
R4677:Ralgapa2	UTSW	2	146345467	missense	possibly damaging	0.82
R4724:Ralgapa2	UTSW	2	146345533	missense	possibly damaging	0.46
R4760:Ralgapa2	UTSW	2	146346749	missense	probably benign	0.00
R4831:Ralgapa2	UTSW	2	146405067	intron	probably benign
R4962:Ralgapa2	UTSW	2	146434834	nonsense	probably null
R4993:Ralgapa2	UTSW	2	146447311	missense	probably damaging	1.00
R5041:Ralgapa2	UTSW	2	146485151	missense	probably benign	0.00
R5120:Ralgapa2	UTSW	2	146412084	missense	probably benign	0.26
R5185:Ralgapa2	UTSW	2	146388486	splice site	probably null
R5393:Ralgapa2	UTSW	2	146345455	missense	probably damaging	1.00
R5428:Ralgapa2	UTSW	2	146334494	missense	probably damaging	0.96
R5439:Ralgapa2	UTSW	2	146342510	missense	probably benign	0.08
R5476:Ralgapa2	UTSW	2	146447436	missense	probably benign
R5695:Ralgapa2	UTSW	2	146333477	missense	probably damaging	1.00
R5705:Ralgapa2	UTSW	2	146449273	missense	probably damaging	1.00
R5718:Ralgapa2	UTSW	2	146453406	splice site	probably null
R5817:Ralgapa2	UTSW	2	146333486	missense	probably damaging	1.00
R5877:Ralgapa2	UTSW	2	146388569	missense	probably damaging	1.00
R5994:Ralgapa2	UTSW	2	146361453	missense	probably benign	0.00
R6048:Ralgapa2	UTSW	2	146434845	missense	possibly damaging	0.46
R6158:Ralgapa2	UTSW	2	146424676	missense	possibly damaging	0.69
R6169:Ralgapa2	UTSW	2	146450465	missense	probably damaging	1.00
R6280:Ralgapa2	UTSW	2	146342209	missense	probably damaging	1.00
R6301:Ralgapa2	UTSW	2	146327411	missense	possibly damaging	0.94
R6650:Ralgapa2	UTSW	2	146388502	missense	probably damaging	1.00
R6959:Ralgapa2	UTSW	2	146342701	missense	probably damaging	0.98
R7020:Ralgapa2	UTSW	2	146346718	nonsense	probably null
R7035:Ralgapa2	UTSW	2	146511857	missense	probably damaging	1.00
R7167:Ralgapa2	UTSW	2	146348454	missense	probably benign
R7186:Ralgapa2	UTSW	2	146388486	splice site	probably null
R7252:Ralgapa2	UTSW	2	146342751	critical splice acceptor site	probably null
R7266:Ralgapa2	UTSW	2	146334568	missense	probably damaging	1.00
R7371:Ralgapa2	UTSW	2	146347126	missense	probably benign	0.05
R7432:Ralgapa2	UTSW	2	146434856	missense	probably benign	0.41
R7470:Ralgapa2	UTSW	2	146424667	missense	probably damaging	1.00
R7663:Ralgapa2	UTSW	2	146418415	missense	probably benign	0.01
R7780:Ralgapa2	UTSW	2	146342414	missense	probably benign	0.14
R8018:Ralgapa2	UTSW	2	146340391	missense	probably damaging	1.00
R8063:Ralgapa2	UTSW	2	146443855	missense	probably damaging	1.00
R8070:Ralgapa2	UTSW	2	146353279	missense	probably damaging	0.98
RF019:Ralgapa2	UTSW	2	146361503	missense	possibly damaging	0.53
X0019:Ralgapa2	UTSW	2	146388652	missense	possibly damaging	0.56
Z1088:Ralgapa2	UTSW	2	146434905	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- GAGACAGAGATGCCAACCAGTC -3'
(R):5'- GCAAGACAGAGCTCACTTAGG -3'

Sequencing Primer
(F):5'- AGTCCACCAGCATGAGGTC -3'
(R):5'- CACTTAGGTGAATAGCCAAGTGAGC -3'

Posted On

2015-06-10