Incidental Mutation 'R4177:Ralgapa2'
ID319544
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4177 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146485163 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 59 (Y59N)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109982
Predicted Effect probably damaging
Transcript: ENSMUST00000109986
AA Change: Y59N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: Y59N

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124709
Predicted Effect probably damaging
Transcript: ENSMUST00000131824
AA Change: Y59N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: Y59N

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135974
Predicted Effect probably damaging
Transcript: ENSMUST00000228797
AA Change: Y59N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aicda A T 6: 122,561,084 D67V probably benign Het
Arhgap32 A G 9: 32,247,214 R182G probably null Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
Bscl2 A G 19: 8,839,756 D16G possibly damaging Het
Celsr2 A G 3: 108,413,978 V506A probably damaging Het
Cenpf T A 1: 189,668,619 Q441L possibly damaging Het
Crebbp A T 16: 4,119,799 M700K possibly damaging Het
Dhcr7 A G 7: 143,841,173 Y142C probably damaging Het
Dnajc2 A G 5: 21,757,396 M602T probably benign Het
Dysf C T 6: 84,067,031 R254* probably null Het
Ednra A C 8: 77,675,048 I204M possibly damaging Het
Fabp2 A G 3: 122,896,898 T77A possibly damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Gm13212 T C 4: 145,620,655 L43S probably damaging Het
Gnb1 T C 4: 155,540,656 probably benign Het
Gpc2 T C 5: 138,277,359 probably benign Het
Kmt2a T C 9: 44,820,983 probably benign Het
Lypla2 T C 4: 135,969,092 probably benign Het
Maf A T 8: 115,706,471 Y131* probably null Het
Mfsd4a T A 1: 132,040,557 H335L probably damaging Het
Mrgpra9 A G 7: 47,235,554 Y122H probably damaging Het
Myo10 A T 15: 25,734,051 Q342L possibly damaging Het
N4bp2 A G 5: 65,798,170 probably null Het
Olfr1095 A T 2: 86,851,401 M99K possibly damaging Het
Pomt1 A G 2: 32,248,677 N435S probably damaging Het
Pram1 A G 17: 33,641,229 I257V probably benign Het
Rab9 G T X: 166,458,300 S5* probably null Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Rps6kc1 G A 1: 190,800,419 T462M possibly damaging Het
Selenoo C T 15: 89,099,459 probably benign Het
Sptb G C 12: 76,613,179 D982E probably benign Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubald1 A G 16: 4,875,881 probably benign Het
Ube2d1 T C 10: 71,258,203 K101R probably damaging Het
Unc5cl A G 17: 48,462,270 T261A probably benign Het
Zcwpw1 G T 5: 137,800,133 K197N probably damaging Het
Zfyve19 A G 2: 119,216,212 T296A possibly damaging Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146348454 missense probably benign
R7186:Ralgapa2 UTSW 2 146388486 splice site probably null
R7252:Ralgapa2 UTSW 2 146342751 critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146334568 missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146347126 missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146434856 missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146424667 missense probably damaging 1.00
R7663:Ralgapa2 UTSW 2 146418415 missense probably benign 0.01
R7780:Ralgapa2 UTSW 2 146342414 missense probably benign 0.14
R8018:Ralgapa2 UTSW 2 146340391 missense probably damaging 1.00
R8063:Ralgapa2 UTSW 2 146443855 missense probably damaging 1.00
R8070:Ralgapa2 UTSW 2 146353279 missense probably damaging 0.98
RF019:Ralgapa2 UTSW 2 146361503 missense possibly damaging 0.53
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GAGACAGAGATGCCAACCAGTC -3'
(R):5'- GCAAGACAGAGCTCACTTAGG -3'

Sequencing Primer
(F):5'- AGTCCACCAGCATGAGGTC -3'
(R):5'- CACTTAGGTGAATAGCCAAGTGAGC -3'
Posted On2015-06-10