Incidental Mutation 'R4177:Fabp2'
ID319547
Institutional Source Beutler Lab
Gene Symbol Fabp2
Ensembl Gene ENSMUSG00000023057
Gene Namefatty acid binding protein 2, intestinal
SynonymsFabpi, Fabpi, I-FABP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4177 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122895072-122899506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122896898 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 77 (T77A)
Ref Sequence ENSEMBL: ENSMUSP00000023820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023820]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023820
AA Change: T77A

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023820
Gene: ENSMUSG00000023057
AA Change: T77A

DomainStartEndE-ValueType
Pfam:Lipocalin_7 1 131 1.2e-9 PFAM
Pfam:Lipocalin 4 132 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199131
Meta Mutation Damage Score 0.2062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within enterocytes, possibly to sense lipids as part of energy homeostasis. In humans polymorphisms are associated with increased fat oxidation and insulin resistance. In mice deficiency of this gene alters body weight in a gender-specific manner and causes hyperinsulinemia. [provided by RefSeq, Jan 2013]
PHENOTYPE: Male mutant mice exhibit increased body weight, hyperinsulinemia, increased leptin levels on a high fat diet and have elevated circulating levels of triglycerides. Female mutant mice exhibit a decreased body weight on a high fat diet compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aicda A T 6: 122,561,084 D67V probably benign Het
Arhgap32 A G 9: 32,247,214 R182G probably null Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
Bscl2 A G 19: 8,839,756 D16G possibly damaging Het
Celsr2 A G 3: 108,413,978 V506A probably damaging Het
Cenpf T A 1: 189,668,619 Q441L possibly damaging Het
Crebbp A T 16: 4,119,799 M700K possibly damaging Het
Dhcr7 A G 7: 143,841,173 Y142C probably damaging Het
Dnajc2 A G 5: 21,757,396 M602T probably benign Het
Dysf C T 6: 84,067,031 R254* probably null Het
Ednra A C 8: 77,675,048 I204M possibly damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Gm13212 T C 4: 145,620,655 L43S probably damaging Het
Gnb1 T C 4: 155,540,656 probably benign Het
Gpc2 T C 5: 138,277,359 probably benign Het
Kmt2a T C 9: 44,820,983 probably benign Het
Lypla2 T C 4: 135,969,092 probably benign Het
Maf A T 8: 115,706,471 Y131* probably null Het
Mfsd4a T A 1: 132,040,557 H335L probably damaging Het
Mrgpra9 A G 7: 47,235,554 Y122H probably damaging Het
Myo10 A T 15: 25,734,051 Q342L possibly damaging Het
N4bp2 A G 5: 65,798,170 probably null Het
Olfr1095 A T 2: 86,851,401 M99K possibly damaging Het
Pomt1 A G 2: 32,248,677 N435S probably damaging Het
Pram1 A G 17: 33,641,229 I257V probably benign Het
Rab9 G T X: 166,458,300 S5* probably null Het
Ralgapa2 A T 2: 146,485,163 Y59N probably damaging Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Rps6kc1 G A 1: 190,800,419 T462M possibly damaging Het
Selenoo C T 15: 89,099,459 probably benign Het
Sptb G C 12: 76,613,179 D982E probably benign Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubald1 A G 16: 4,875,881 probably benign Het
Ube2d1 T C 10: 71,258,203 K101R probably damaging Het
Unc5cl A G 17: 48,462,270 T261A probably benign Het
Zcwpw1 G T 5: 137,800,133 K197N probably damaging Het
Zfyve19 A G 2: 119,216,212 T296A possibly damaging Het
Other mutations in Fabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02326:Fabp2 APN 3 122898746 missense probably damaging 1.00
IGL02569:Fabp2 APN 3 122895464 missense probably damaging 0.99
R7389:Fabp2 UTSW 3 122895365 start gained probably benign
R8190:Fabp2 UTSW 3 122896770 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCGTTGCAGGCATTAATGTG -3'
(R):5'- TGAAGAAGGTTTGCATTAGCTG -3'

Sequencing Primer
(F):5'- CGTTGCAGGCATTAATGTGATGAAG -3'
(R):5'- TGTTCATTCAGAGATGAGGCACC -3'
Posted On2015-06-10