Incidental Mutation 'R4177:Mrgpra9'
ID319557
Institutional Source Beutler Lab
Gene Symbol Mrgpra9
Ensembl Gene ENSMUSG00000074111
Gene NameMAS-related GPR, member A9
SynonymsEG668725, MrgA9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4177 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47234861-47252848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47235554 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 122 (Y122H)
Ref Sequence ENSEMBL: ENSMUSP00000136396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098436] [ENSMUST00000179005]
Predicted Effect probably damaging
Transcript: ENSMUST00000098436
AA Change: Y121H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096035
Gene: ENSMUSG00000074111
AA Change: Y121H

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:7tm_1 56 225 1.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179005
AA Change: Y122H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136396
Gene: ENSMUSG00000074111
AA Change: Y122H

DomainStartEndE-ValueType
Pfam:7tm_1 12 178 3.4e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aicda A T 6: 122,561,084 D67V probably benign Het
Arhgap32 A G 9: 32,247,214 R182G probably null Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
Bscl2 A G 19: 8,839,756 D16G possibly damaging Het
Celsr2 A G 3: 108,413,978 V506A probably damaging Het
Cenpf T A 1: 189,668,619 Q441L possibly damaging Het
Crebbp A T 16: 4,119,799 M700K possibly damaging Het
Dhcr7 A G 7: 143,841,173 Y142C probably damaging Het
Dnajc2 A G 5: 21,757,396 M602T probably benign Het
Dysf C T 6: 84,067,031 R254* probably null Het
Ednra A C 8: 77,675,048 I204M possibly damaging Het
Fabp2 A G 3: 122,896,898 T77A possibly damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Gm13212 T C 4: 145,620,655 L43S probably damaging Het
Gnb1 T C 4: 155,540,656 probably benign Het
Gpc2 T C 5: 138,277,359 probably benign Het
Kmt2a T C 9: 44,820,983 probably benign Het
Lypla2 T C 4: 135,969,092 probably benign Het
Maf A T 8: 115,706,471 Y131* probably null Het
Mfsd4a T A 1: 132,040,557 H335L probably damaging Het
Myo10 A T 15: 25,734,051 Q342L possibly damaging Het
N4bp2 A G 5: 65,798,170 probably null Het
Olfr1095 A T 2: 86,851,401 M99K possibly damaging Het
Pomt1 A G 2: 32,248,677 N435S probably damaging Het
Pram1 A G 17: 33,641,229 I257V probably benign Het
Rab9 G T X: 166,458,300 S5* probably null Het
Ralgapa2 A T 2: 146,485,163 Y59N probably damaging Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Rps6kc1 G A 1: 190,800,419 T462M possibly damaging Het
Selenoo C T 15: 89,099,459 probably benign Het
Sptb G C 12: 76,613,179 D982E probably benign Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubald1 A G 16: 4,875,881 probably benign Het
Ube2d1 T C 10: 71,258,203 K101R probably damaging Het
Unc5cl A G 17: 48,462,270 T261A probably benign Het
Zcwpw1 G T 5: 137,800,133 K197N probably damaging Het
Zfyve19 A G 2: 119,216,212 T296A possibly damaging Het
Other mutations in Mrgpra9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mrgpra9 APN 7 47235091 missense possibly damaging 0.85
IGL00575:Mrgpra9 APN 7 47235305 missense possibly damaging 0.76
IGL01649:Mrgpra9 APN 7 47235152 missense probably benign 0.22
IGL03207:Mrgpra9 APN 7 47235637 missense possibly damaging 0.68
R0388:Mrgpra9 UTSW 7 47252794 start codon destroyed probably null 0.08
R0972:Mrgpra9 UTSW 7 47235455 missense probably damaging 0.99
R1270:Mrgpra9 UTSW 7 47252783 critical splice donor site probably null
R1381:Mrgpra9 UTSW 7 47235302 missense possibly damaging 0.75
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1448:Mrgpra9 UTSW 7 47235813 missense probably benign 0.02
R2045:Mrgpra9 UTSW 7 47235835 missense probably benign
R2144:Mrgpra9 UTSW 7 47235463 missense probably benign 0.31
R2187:Mrgpra9 UTSW 7 47235049 missense probably damaging 1.00
R2507:Mrgpra9 UTSW 7 47235494 missense possibly damaging 0.63
R2913:Mrgpra9 UTSW 7 47235080 missense probably benign
R3810:Mrgpra9 UTSW 7 47235779 missense probably damaging 0.98
R4521:Mrgpra9 UTSW 7 47235190 missense probably damaging 1.00
R4781:Mrgpra9 UTSW 7 47235047 missense possibly damaging 0.88
R4926:Mrgpra9 UTSW 7 47235011 missense possibly damaging 0.62
R6469:Mrgpra9 UTSW 7 47235106 missense probably benign 0.02
R6505:Mrgpra9 UTSW 7 47235136 missense probably benign 0.00
R6724:Mrgpra9 UTSW 7 47235038 missense probably damaging 1.00
R7398:Mrgpra9 UTSW 7 47235637 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ATGCCATACACCCATAGTCATTTAC -3'
(R):5'- AAACGCCATTGTGTTCTGGC -3'

Sequencing Primer
(F):5'- TGGTATCTAAGAAACCGCAGAAATAC -3'
(R):5'- CCATTGTGTTCTGGCTCCTGG -3'
Posted On2015-06-10