Incidental Mutation 'R4177:Dhcr7'
ID 319559
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4177 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143394910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 142 (Y142C)
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000207143] [ENSMUST00000145471] [ENSMUST00000144034]
AlphaFold O88455
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: Y139C

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: Y139C

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125564
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: Y139C

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143338
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: Y139C

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207143
AA Change: Y142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208631
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Meta Mutation Damage Score 0.9746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aicda A T 6: 122,538,043 (GRCm39) D67V probably benign Het
Arhgap32 A G 9: 32,158,510 (GRCm39) R182G probably null Het
Bbx T C 16: 50,045,221 (GRCm39) K447E probably damaging Het
Bscl2 A G 19: 8,817,120 (GRCm39) D16G possibly damaging Het
Celsr2 A G 3: 108,321,294 (GRCm39) V506A probably damaging Het
Cenpf T A 1: 189,400,816 (GRCm39) Q441L possibly damaging Het
Crebbp A T 16: 3,937,663 (GRCm39) M700K possibly damaging Het
Dnajc2 A G 5: 21,962,394 (GRCm39) M602T probably benign Het
Dysf C T 6: 84,044,013 (GRCm39) R254* probably null Het
Ednra A C 8: 78,401,677 (GRCm39) I204M possibly damaging Het
Fabp2 A G 3: 122,690,547 (GRCm39) T77A possibly damaging Het
Gm10322 C A 10: 59,452,052 (GRCm39) N56K probably benign Het
Gnb1 T C 4: 155,625,113 (GRCm39) probably benign Het
Gpc2 T C 5: 138,275,621 (GRCm39) probably benign Het
Kmt2a T C 9: 44,732,280 (GRCm39) probably benign Het
Lypla2 T C 4: 135,696,403 (GRCm39) probably benign Het
Maf A T 8: 116,433,210 (GRCm39) Y131* probably null Het
Mfsd4a T A 1: 131,968,295 (GRCm39) H335L probably damaging Het
Mrgpra9 A G 7: 46,885,302 (GRCm39) Y122H probably damaging Het
Myo10 A T 15: 25,734,137 (GRCm39) Q342L possibly damaging Het
N4bp2 A G 5: 65,955,513 (GRCm39) probably null Het
Or5t15 A T 2: 86,681,745 (GRCm39) M99K possibly damaging Het
Pomt1 A G 2: 32,138,689 (GRCm39) N435S probably damaging Het
Pram1 A G 17: 33,860,203 (GRCm39) I257V probably benign Het
Rab9 G T X: 165,241,296 (GRCm39) S5* probably null Het
Ralgapa2 A T 2: 146,327,083 (GRCm39) Y59N probably damaging Het
Rasgrf2 C T 13: 92,038,717 (GRCm39) G1043D probably damaging Het
Rps6kc1 G A 1: 190,532,616 (GRCm39) T462M possibly damaging Het
Selenoo C T 15: 88,983,662 (GRCm39) probably benign Het
Sptb G C 12: 76,659,953 (GRCm39) D982E probably benign Het
Tab2 A G 10: 7,795,123 (GRCm39) V453A probably damaging Het
Ubald1 A G 16: 4,693,745 (GRCm39) probably benign Het
Ube2d1 T C 10: 71,094,033 (GRCm39) K101R probably damaging Het
Unc5cl A G 17: 48,769,298 (GRCm39) T261A probably benign Het
Zcwpw1 G T 5: 137,798,395 (GRCm39) K197N probably damaging Het
Zfp268 T C 4: 145,347,225 (GRCm39) L43S probably damaging Het
Zfyve19 A G 2: 119,046,693 (GRCm39) T296A possibly damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143,391,507 (GRCm39) missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143,401,167 (GRCm39) missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143,391,528 (GRCm39) missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143,390,468 (GRCm39) critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9006:Dhcr7 UTSW 7 143,394,978 (GRCm39) missense probably benign
R9052:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.79
R9629:Dhcr7 UTSW 7 143,401,212 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGCTACTAGCCTTTAAGCC -3'
(R):5'- TTACCAGTCTTCGGCACTGG -3'

Sequencing Primer
(F):5'- GCCTTTAAGCCTGGGTATGAAAC -3'
(R):5'- GGGGAACAGGTAGCCCTTGATC -3'
Posted On 2015-06-10