Mutagenetix > Incidental Mutations

Incidental Mutation 'R4177:Sptb'

319566

Institutional Source

Beutler Lab

Gene Symbol

Sptb

Ensembl Gene

ENSMUSG00000021061

Gene Name

spectrin beta, erythrocytic

Synonyms

LOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.901) question?

Stock #

R4177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76580488-76710547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 76613179 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 982 (D982E)

Ref Sequence

ENSEMBL: ENSMUSP00000021458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]

Predicted Effect

probably benign
Transcript: ENSMUST00000021458
AA Change: D982E

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: D982E

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.04e-10	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2193	4.32e-9	SMART
PH	2180	2291	8.98e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166101
AA Change: D982E

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: D982E

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.87e-11	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2117	1.16e-9	SMART

Meta Mutation Damage Score

0.1178

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aicda	A	T	6: 122,561,084	D67V	probably benign	Het
Arhgap32	A	G	9: 32,247,214	R182G	probably null	Het
Bbx	T	C	16: 50,224,858	K447E	probably damaging	Het
Bscl2	A	G	19: 8,839,756	D16G	possibly damaging	Het
Celsr2	A	G	3: 108,413,978	V506A	probably damaging	Het
Cenpf	T	A	1: 189,668,619	Q441L	possibly damaging	Het
Crebbp	A	T	16: 4,119,799	M700K	possibly damaging	Het
Dhcr7	A	G	7: 143,841,173	Y142C	probably damaging	Het
Dnajc2	A	G	5: 21,757,396	M602T	probably benign	Het
Dysf	C	T	6: 84,067,031	R254*	probably null	Het
Ednra	A	C	8: 77,675,048	I204M	possibly damaging	Het
Fabp2	A	G	3: 122,896,898	T77A	possibly damaging	Het
Gm10322	C	A	10: 59,616,230	N56K	probably benign	Het
Gm13212	T	C	4: 145,620,655	L43S	probably damaging	Het
Gnb1	T	C	4: 155,540,656		probably benign	Het
Gpc2	T	C	5: 138,277,359		probably benign	Het
Kmt2a	T	C	9: 44,820,983		probably benign	Het
Lypla2	T	C	4: 135,969,092		probably benign	Het
Maf	A	T	8: 115,706,471	Y131*	probably null	Het
Mfsd4a	T	A	1: 132,040,557	H335L	probably damaging	Het
Mrgpra9	A	G	7: 47,235,554	Y122H	probably damaging	Het
Myo10	A	T	15: 25,734,051	Q342L	possibly damaging	Het
N4bp2	A	G	5: 65,798,170		probably null	Het
Olfr1095	A	T	2: 86,851,401	M99K	possibly damaging	Het
Pomt1	A	G	2: 32,248,677	N435S	probably damaging	Het
Pram1	A	G	17: 33,641,229	I257V	probably benign	Het
Rab9	G	T	X: 166,458,300	S5*	probably null	Het
Ralgapa2	A	T	2: 146,485,163	Y59N	probably damaging	Het
Rasgrf2	C	T	13: 91,890,598	G1043D	probably damaging	Het
Rps6kc1	G	A	1: 190,800,419	T462M	possibly damaging	Het
Selenoo	C	T	15: 89,099,459		probably benign	Het
Tab2	A	G	10: 7,919,359	V453A	probably damaging	Het
Ubald1	A	G	16: 4,875,881		probably benign	Het
Ube2d1	T	C	10: 71,258,203	K101R	probably damaging	Het
Unc5cl	A	G	17: 48,462,270	T261A	probably benign	Het
Zcwpw1	G	T	5: 137,800,133	K197N	probably damaging	Het
Zfyve19	A	G	2: 119,216,212	T296A	possibly damaging	Het

Other mutations in Sptb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Sptb	APN	12	76621331	missense	probably benign	0.00
IGL00160:Sptb	APN	12	76623169	missense	probably damaging	1.00
IGL00229:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL00820:Sptb	APN	12	76632477	missense	probably damaging	1.00
IGL01309:Sptb	APN	12	76587463	missense	probably benign	0.16
IGL01408:Sptb	APN	12	76613147	missense	possibly damaging	0.93
IGL01450:Sptb	APN	12	76624240	missense	possibly damaging	0.89
IGL01455:Sptb	APN	12	76612912	missense	probably damaging	1.00
IGL01457:Sptb	APN	12	76612555	splice site	probably benign
IGL01680:Sptb	APN	12	76630682	missense	probably damaging	1.00
IGL02070:Sptb	APN	12	76605539	missense	possibly damaging	0.82
IGL02346:Sptb	APN	12	76621014	missense	probably damaging	1.00
IGL02452:Sptb	APN	12	76609036	critical splice donor site	probably null
IGL02515:Sptb	APN	12	76606487	missense	possibly damaging	0.51
IGL02545:Sptb	APN	12	76607980	critical splice donor site	probably null
IGL02644:Sptb	APN	12	76605617	missense	probably damaging	1.00
IGL02878:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL03007:Sptb	APN	12	76621341	missense	probably damaging	1.00
IGL03220:Sptb	APN	12	76612910	missense	probably benign	0.06
IGL03343:Sptb	APN	12	76583556	unclassified	probably benign
IGL03098:Sptb	UTSW	12	76621499	missense	probably damaging	1.00
PIT4472001:Sptb	UTSW	12	76620686	missense	probably damaging	1.00
R0047:Sptb	UTSW	12	76622950	missense	probably damaging	0.99
R0365:Sptb	UTSW	12	76600383	missense	probably benign	0.12
R0373:Sptb	UTSW	12	76621371	missense	probably benign	0.03
R0704:Sptb	UTSW	12	76583594	missense	probably damaging	0.99
R1005:Sptb	UTSW	12	76601859	critical splice donor site	probably null
R1109:Sptb	UTSW	12	76603603	missense	probably damaging	1.00
R1264:Sptb	UTSW	12	76612607	missense	probably damaging	1.00
R1358:Sptb	UTSW	12	76621321	frame shift	probably null
R1358:Sptb	UTSW	12	76621326	missense	probably damaging	1.00
R1459:Sptb	UTSW	12	76611883	missense	probably benign	0.01
R1518:Sptb	UTSW	12	76604024	missense	possibly damaging	0.95
R1628:Sptb	UTSW	12	76583848	missense	probably damaging	1.00
R1668:Sptb	UTSW	12	76621169	missense	probably benign
R1677:Sptb	UTSW	12	76629649	missense	probably damaging	1.00
R1687:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R1695:Sptb	UTSW	12	76620867	missense	probably benign	0.10
R1708:Sptb	UTSW	12	76612574	missense	probably damaging	1.00
R1761:Sptb	UTSW	12	76612608	missense	probably damaging	0.96
R1925:Sptb	UTSW	12	76622253	missense	probably damaging	1.00
R2011:Sptb	UTSW	12	76632472	missense	possibly damaging	0.95
R2373:Sptb	UTSW	12	76621161	missense	probably damaging	1.00
R2517:Sptb	UTSW	12	76649869	missense	possibly damaging	0.55
R2918:Sptb	UTSW	12	76598758	missense	probably damaging	0.97
R2961:Sptb	UTSW	12	76603582	missense	probably benign	0.19
R3409:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3410:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3411:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3744:Sptb	UTSW	12	76600400	missense	probably benign
R4112:Sptb	UTSW	12	76597779	missense	probably damaging	0.99
R4194:Sptb	UTSW	12	76613010	missense	probably benign	0.44
R4301:Sptb	UTSW	12	76612697	missense	probably damaging	1.00
R4555:Sptb	UTSW	12	76612851	missense	probably benign	0.03
R4619:Sptb	UTSW	12	76583807	nonsense	probably null
R4620:Sptb	UTSW	12	76583807	nonsense	probably null
R4625:Sptb	UTSW	12	76587326	splice site	probably null
R4728:Sptb	UTSW	12	76583379	missense	probably benign	0.00
R4751:Sptb	UTSW	12	76627110	missense	probably benign	0.07
R4810:Sptb	UTSW	12	76623197	nonsense	probably null
R4888:Sptb	UTSW	12	76609037	missense	probably benign	0.00
R4894:Sptb	UTSW	12	76624994	critical splice donor site	probably null
R5114:Sptb	UTSW	12	76609278	missense	probably damaging	1.00
R5191:Sptb	UTSW	12	76612834	missense	probably benign	0.12
R5479:Sptb	UTSW	12	76599851	missense	probably benign	0.04
R5646:Sptb	UTSW	12	76587441	missense	probably benign
R5725:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5727:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5797:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R5874:Sptb	UTSW	12	76598727	missense	possibly damaging	0.91
R5952:Sptb	UTSW	12	76632384	missense	probably benign	0.02
R5956:Sptb	UTSW	12	76604168	missense	probably benign
R6298:Sptb	UTSW	12	76620654	critical splice donor site	probably null
R6470:Sptb	UTSW	12	76612829	missense	probably damaging	1.00
R6477:Sptb	UTSW	12	76606392	missense	probably damaging	1.00
R6736:Sptb	UTSW	12	76613180	missense	possibly damaging	0.49
R6854:Sptb	UTSW	12	76603480	missense	probably damaging	1.00
R6969:Sptb	UTSW	12	76608007	missense	probably damaging	1.00
R6987:Sptb	UTSW	12	76613247	missense	probably benign	0.00
R7023:Sptb	UTSW	12	76625088	missense	probably damaging	1.00
R7366:Sptb	UTSW	12	76604194	missense	probably damaging	1.00
R7379:Sptb	UTSW	12	76610877	missense	probably damaging	1.00
R7389:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7392:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7477:Sptb	UTSW	12	76628565	missense	probably damaging	1.00
R7653:Sptb	UTSW	12	76628497	missense	probably benign	0.06
R7684:Sptb	UTSW	12	76612195	missense	probably benign	0.06
R7733:Sptb	UTSW	12	76597921	splice site	probably null
R7846:Sptb	UTSW	12	76608526	nonsense	probably null
R8048:Sptb	UTSW	12	76628559	missense	probably benign	0.02
R8261:Sptb	UTSW	12	76621262	missense	probably benign	0.06
R8324:Sptb	UTSW	12	76619162	missense	possibly damaging	0.73
R8512:Sptb	UTSW	12	76602052	missense	possibly damaging	0.51
R8515:Sptb	UTSW	12	76612041	missense	probably benign	0.10
X0057:Sptb	UTSW	12	76630739	missense	probably benign
Z1176:Sptb	UTSW	12	76620733	nonsense	probably null
Z1177:Sptb	UTSW	12	76583584	missense	probably damaging	1.00
Z1177:Sptb	UTSW	12	76606445	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AGAGCTCCTGACCTTGCAAG -3'
(R):5'- TGTCTGTGTCTCCTCTGGGAAC -3'

Sequencing Primer
(F):5'- TTGCAGGCCCTTCCACAG -3'
(R):5'- GAACGGTGTGGTATCCTTTTTCCC -3'

Posted On

2015-06-10