Incidental Mutation 'R4178:Fkbp14'
ID319590
Institutional Source Beutler Lab
Gene Symbol Fkbp14
Ensembl Gene ENSMUSG00000038074
Gene NameFK506 binding protein 14
SynonymsFKBP22
MMRRC Submission 040864-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R4178 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location54577604-54597308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54589314 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 103 (L103P)
Ref Sequence ENSEMBL: ENSMUSP00000114521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046520] [ENSMUST00000117375] [ENSMUST00000155047]
Predicted Effect probably damaging
Transcript: ENSMUST00000046520
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046070
Gene: ENSMUSG00000038074
AA Change: L103P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 38 132 2e-28 PFAM
Pfam:EF-hand_7 116 207 3.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117375
AA Change: L9P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112526
Gene: ENSMUSG00000038074
AA Change: L9P

DomainStartEndE-ValueType
Pfam:FKBP_C 1 38 1.1e-13 PFAM
EFh 45 73 4.08e1 SMART
EFh 89 117 2.56e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133446
AA Change: S244P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143312
Predicted Effect probably damaging
Transcript: ENSMUST00000155047
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114521
Gene: ENSMUSG00000038074
AA Change: L103P

DomainStartEndE-ValueType
Pfam:FKBP_C 38 117 7.3e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FK506-binding protein family of peptidyl-prolyl cis-trans isomerases. The encoded protein is found in the lumen of the endoplasmic reticulum, where it is thought to accelerate protein folding. Defects in this gene are a cause of a type of Ehlers-Danlos syndrome (EDS). Both a protein-coding variant and noncoding variants are transcribed from this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl A G 14: 34,054,971 probably null Het
Atp2b2 A T 6: 113,793,718 V410E probably damaging Het
C6 G A 15: 4,735,139 V106I probably benign Het
Cdhr1 A C 14: 37,082,939 probably null Het
Cfap44 T A 16: 44,451,853 L1323Q possibly damaging Het
Ehd4 T A 2: 120,154,348 Y43F probably damaging Het
Eno1 T C 4: 150,244,033 I90T possibly damaging Het
Epb41l1 A G 2: 156,521,557 Y662C probably benign Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Iqcd C A 5: 120,602,411 T269K probably damaging Het
Kat6b T A 14: 21,618,904 C249* probably null Het
Kcnab2 T C 4: 152,404,601 R109G probably null Het
Obox7 C A 7: 14,664,106 Q24K probably damaging Het
Obox7 A G 7: 14,664,107 Q24R probably damaging Het
Olfr1537 A C 9: 39,238,079 L115* probably null Het
Olfr491 A G 7: 108,317,358 N155D probably damaging Het
Olfr493 G A 7: 108,346,558 T141I probably benign Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Slf1 A G 13: 77,043,569 S1049P probably damaging Het
Smc1b A T 15: 85,120,647 F409I possibly damaging Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubr4 A G 4: 139,393,414 Y338C probably damaging Het
Usp6nl A G 2: 6,440,976 E588G probably benign Het
Vcan T C 13: 89,725,547 R63G probably damaging Het
Zfp775 A G 6: 48,613,253 probably null Het
Zfpm2 T C 15: 41,103,544 C1010R probably damaging Het
Other mutations in Fkbp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02953:Fkbp14 APN 6 54579682 missense probably damaging 1.00
IGL03056:Fkbp14 APN 6 54579544 missense probably benign 0.00
R4863:Fkbp14 UTSW 6 54585945 splice site probably benign
R4975:Fkbp14 UTSW 6 54592958 missense probably benign 0.01
R5710:Fkbp14 UTSW 6 54589270 splice site probably null
R5714:Fkbp14 UTSW 6 54585850 missense probably damaging 1.00
R6671:Fkbp14 UTSW 6 54579677 missense probably damaging 1.00
R6792:Fkbp14 UTSW 6 54585852 nonsense probably null
R7606:Fkbp14 UTSW 6 54593018 missense probably benign 0.01
R7748:Fkbp14 UTSW 6 54595520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGTAGGGTCACTCAGCAGG -3'
(R):5'- CATGAAGCACAGCAAGAATCTTTG -3'

Sequencing Primer
(F):5'- TCACTCAGCAGGGAGGGTC -3'
(R):5'- TTACCTAGCATGCACAGGGCTC -3'
Posted On2015-06-10