Incidental Mutation 'R4178:Olfr491'
ID319595
Institutional Source Beutler Lab
Gene Symbol Olfr491
Ensembl Gene ENSMUSG00000094612
Gene Nameolfactory receptor 491
SynonymsMOR204-11, GA_x6K02T2PBJ9-10646917-10647849
MMRRC Submission 040864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4178 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108313451-108318827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108317358 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 155 (N155D)
Ref Sequence ENSEMBL: ENSMUSP00000150694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053179] [ENSMUST00000209545] [ENSMUST00000214605]
Predicted Effect probably damaging
Transcript: ENSMUST00000053179
AA Change: N155D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061188
Gene: ENSMUSG00000094612
AA Change: N155D

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.4e-50 PFAM
Pfam:7tm_1 41 290 5.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209545
AA Change: N155D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214605
AA Change: N155D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl A G 14: 34,054,971 probably null Het
Atp2b2 A T 6: 113,793,718 V410E probably damaging Het
C6 G A 15: 4,735,139 V106I probably benign Het
Cdhr1 A C 14: 37,082,939 probably null Het
Cfap44 T A 16: 44,451,853 L1323Q possibly damaging Het
Ehd4 T A 2: 120,154,348 Y43F probably damaging Het
Eno1 T C 4: 150,244,033 I90T possibly damaging Het
Epb41l1 A G 2: 156,521,557 Y662C probably benign Het
Fkbp14 A G 6: 54,589,314 L103P probably damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Iqcd C A 5: 120,602,411 T269K probably damaging Het
Kat6b T A 14: 21,618,904 C249* probably null Het
Kcnab2 T C 4: 152,404,601 R109G probably null Het
Obox7 C A 7: 14,664,106 Q24K probably damaging Het
Obox7 A G 7: 14,664,107 Q24R probably damaging Het
Olfr1537 A C 9: 39,238,079 L115* probably null Het
Olfr493 G A 7: 108,346,558 T141I probably benign Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Slf1 A G 13: 77,043,569 S1049P probably damaging Het
Smc1b A T 15: 85,120,647 F409I possibly damaging Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubr4 A G 4: 139,393,414 Y338C probably damaging Het
Usp6nl A G 2: 6,440,976 E588G probably benign Het
Vcan T C 13: 89,725,547 R63G probably damaging Het
Zfp775 A G 6: 48,613,253 probably null Het
Zfpm2 T C 15: 41,103,544 C1010R probably damaging Het
Other mutations in Olfr491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Olfr491 APN 7 108317518 missense probably benign 0.02
IGL01731:Olfr491 APN 7 108317475 missense probably benign 0.01
IGL02227:Olfr491 APN 7 108317201 nonsense probably null
IGL02624:Olfr491 APN 7 108316923 missense probably benign 0.38
IGL03164:Olfr491 APN 7 108317694 missense probably damaging 1.00
R0143:Olfr491 UTSW 7 108316995 missense probably benign 0.00
R0217:Olfr491 UTSW 7 108317298 missense probably benign 0.00
R0295:Olfr491 UTSW 7 108317685 missense probably benign 0.42
R2100:Olfr491 UTSW 7 108317554 missense probably benign 0.04
R2379:Olfr491 UTSW 7 108317292 missense probably benign 0.25
R4365:Olfr491 UTSW 7 108317106 missense probably benign 0.02
R4734:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R4828:Olfr491 UTSW 7 108317470 missense probably benign 0.00
R6424:Olfr491 UTSW 7 108317205 missense probably benign 0.01
R6784:Olfr491 UTSW 7 108317782 missense probably damaging 0.98
R7109:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R7348:Olfr491 UTSW 7 108317713 missense possibly damaging 0.58
R7590:Olfr491 UTSW 7 108317179 missense probably benign 0.00
X0060:Olfr491 UTSW 7 108317220 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATGCCTGTGAAGCACAACTC -3'
(R):5'- ATCTTCAGGATGGTGATAAGGATGTAG -3'

Sequencing Primer
(F):5'- GTGAAGCACAACTCTGTTCTG -3'
(R):5'- TGTAGGAGACAGATATGACAAACAC -3'
Posted On2015-06-10