Incidental Mutation 'R4178:Antxrl'
ID319604
Institutional Source Beutler Lab
Gene Symbol Antxrl
Ensembl Gene ENSMUSG00000047441
Gene Nameanthrax toxin receptor-like
Synonyms
MMRRC Submission 040864-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4178 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34052707-34076405 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 34054971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058725] [ENSMUST00000178958] [ENSMUST00000226211] [ENSMUST00000227979]
Predicted Effect probably null
Transcript: ENSMUST00000058725
SMART Domains Protein: ENSMUSP00000052816
Gene: ENSMUSG00000047441

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 74 248 2.9e-19 SMART
Pfam:Anth_Ig 249 351 6.7e-41 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 392 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215823
Predicted Effect probably null
Transcript: ENSMUST00000226211
Predicted Effect probably null
Transcript: ENSMUST00000227979
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b2 A T 6: 113,793,718 V410E probably damaging Het
C6 G A 15: 4,735,139 V106I probably benign Het
Cdhr1 A C 14: 37,082,939 probably null Het
Cfap44 T A 16: 44,451,853 L1323Q possibly damaging Het
Ehd4 T A 2: 120,154,348 Y43F probably damaging Het
Eno1 T C 4: 150,244,033 I90T possibly damaging Het
Epb41l1 A G 2: 156,521,557 Y662C probably benign Het
Fkbp14 A G 6: 54,589,314 L103P probably damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Iqcd C A 5: 120,602,411 T269K probably damaging Het
Kat6b T A 14: 21,618,904 C249* probably null Het
Kcnab2 T C 4: 152,404,601 R109G probably null Het
Obox7 C A 7: 14,664,106 Q24K probably damaging Het
Obox7 A G 7: 14,664,107 Q24R probably damaging Het
Olfr1537 A C 9: 39,238,079 L115* probably null Het
Olfr491 A G 7: 108,317,358 N155D probably damaging Het
Olfr493 G A 7: 108,346,558 T141I probably benign Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Slf1 A G 13: 77,043,569 S1049P probably damaging Het
Smc1b A T 15: 85,120,647 F409I possibly damaging Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubr4 A G 4: 139,393,414 Y338C probably damaging Het
Usp6nl A G 2: 6,440,976 E588G probably benign Het
Vcan T C 13: 89,725,547 R63G probably damaging Het
Zfp775 A G 6: 48,613,253 probably null Het
Zfpm2 T C 15: 41,103,544 C1010R probably damaging Het
Other mutations in Antxrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Antxrl APN 14 34075597 missense probably benign 0.01
IGL01632:Antxrl APN 14 34067947 missense probably damaging 0.99
IGL02379:Antxrl APN 14 34056535 splice site probably null
IGL02381:Antxrl APN 14 34056611 splice site probably null
IGL02736:Antxrl APN 14 34056618 unclassified probably benign
R0631:Antxrl UTSW 14 34058801 critical splice donor site probably null
R1190:Antxrl UTSW 14 34069250 missense probably benign 0.00
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1454:Antxrl UTSW 14 34060949 missense probably damaging 0.99
R1469:Antxrl UTSW 14 34067431 intron probably benign
R1638:Antxrl UTSW 14 34070496 critical splice donor site probably null
R1996:Antxrl UTSW 14 34075829 missense probably benign 0.01
R2174:Antxrl UTSW 14 34060400 missense probably damaging 1.00
R2421:Antxrl UTSW 14 34071689 intron probably benign
R3850:Antxrl UTSW 14 34067381 missense probably benign 0.00
R4434:Antxrl UTSW 14 34071617 intron probably benign
R4603:Antxrl UTSW 14 34075835 missense possibly damaging 0.72
R4769:Antxrl UTSW 14 34073070 missense possibly damaging 0.53
R6003:Antxrl UTSW 14 34075635 missense possibly damaging 0.72
R6047:Antxrl UTSW 14 34053476 intron probably benign
R6228:Antxrl UTSW 14 34056599 missense probably damaging 1.00
R6363:Antxrl UTSW 14 34069287 missense probably damaging 1.00
R6525:Antxrl UTSW 14 34060406 missense probably damaging 1.00
R6800:Antxrl UTSW 14 34065907 missense probably damaging 1.00
R6933:Antxrl UTSW 14 34075771 missense possibly damaging 0.53
R7086:Antxrl UTSW 14 34065916 missense probably benign 0.26
R7257:Antxrl UTSW 14 34065849 missense probably benign 0.03
R7315:Antxrl UTSW 14 34071547 missense unknown
R7981:Antxrl UTSW 14 34065881 missense probably damaging 0.99
X0028:Antxrl UTSW 14 34053915 critical splice donor site probably null
Z1088:Antxrl UTSW 14 34067971 missense probably damaging 1.00
Z1177:Antxrl UTSW 14 34067930 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTGCAGCAGTAACAAGGGG -3'
(R):5'- AAGACCCTGAAAGTTTTCTCTGAG -3'

Sequencing Primer
(F):5'- GGCAGGTTGCTAAAAATCCTG -3'
(R):5'- AAAGTTTTCTCTGAGAGTTTTTGCC -3'
Posted On2015-06-10