Mutagenetix > Incidental Mutations

Incidental Mutation 'R4178:Cdhr1'

319605

Institutional Source

Beutler Lab

Gene Symbol

Cdhr1

Ensembl Gene

ENSMUSG00000021803

Gene Name

cadherin-related family member 1

Synonyms

Pcdh21, Prcad

MMRRC Submission

040864-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R4178 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37077857-37098347 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 37082939 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022337]

Predicted Effect

probably null
Transcript: ENSMUST00000022337

SMART Domains

Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	57	133	9.4e-7	SMART
CA	157	245	9.44e-21	SMART
CA	269	352	2.06e-12	SMART
CA	383	471	2.68e-11	SMART
CA	495	575	5.26e-19	SMART
CA	594	685	1.64e-6	SMART
transmembrane domain	703	725	N/A	INTRINSIC
low complexity region	734	745	N/A	INTRINSIC
low complexity region	789	799	N/A	INTRINSIC
low complexity region	817	829	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Antxrl	A	G	14: 34,054,971		probably null	Het
Atp2b2	A	T	6: 113,793,718	V410E	probably damaging	Het
C6	G	A	15: 4,735,139	V106I	probably benign	Het
Cfap44	T	A	16: 44,451,853	L1323Q	possibly damaging	Het
Ehd4	T	A	2: 120,154,348	Y43F	probably damaging	Het
Eno1	T	C	4: 150,244,033	I90T	possibly damaging	Het
Epb41l1	A	G	2: 156,521,557	Y662C	probably benign	Het
Fkbp14	A	G	6: 54,589,314	L103P	probably damaging	Het
Gm10322	C	A	10: 59,616,230	N56K	probably benign	Het
Iqcd	C	A	5: 120,602,411	T269K	probably damaging	Het
Kat6b	T	A	14: 21,618,904	C249*	probably null	Het
Kcnab2	T	C	4: 152,404,601	R109G	probably null	Het
Obox7	C	A	7: 14,664,106	Q24K	probably damaging	Het
Obox7	A	G	7: 14,664,107	Q24R	probably damaging	Het
Olfr1537	A	C	9: 39,238,079	L115*	probably null	Het
Olfr491	A	G	7: 108,317,358	N155D	probably damaging	Het
Olfr493	G	A	7: 108,346,558	T141I	probably benign	Het
Rasgrf2	C	T	13: 91,890,598	G1043D	probably damaging	Het
Slf1	A	G	13: 77,043,569	S1049P	probably damaging	Het
Smc1b	A	T	15: 85,120,647	F409I	possibly damaging	Het
Tab2	A	G	10: 7,919,359	V453A	probably damaging	Het
Ubr4	A	G	4: 139,393,414	Y338C	probably damaging	Het
Usp6nl	A	G	2: 6,440,976	E588G	probably benign	Het
Vcan	T	C	13: 89,725,547	R63G	probably damaging	Het
Zfp775	A	G	6: 48,613,253		probably null	Het
Zfpm2	T	C	15: 41,103,544	C1010R	probably damaging	Het

Other mutations in Cdhr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Cdhr1	APN	14	37085528	missense	probably benign	0.06
IGL01820:Cdhr1	APN	14	37085579	missense	probably benign	0.11
IGL02469:Cdhr1	APN	14	37085600	missense	possibly damaging	0.68
IGL03373:Cdhr1	APN	14	37096300	missense	possibly damaging	0.89
IGL03055:Cdhr1	UTSW	14	37095097	missense	probably benign	0.07
PIT4494001:Cdhr1	UTSW	14	37082856	missense	probably benign	0.07
R0110:Cdhr1	UTSW	14	37080676	missense	probably damaging	0.99
R0219:Cdhr1	UTSW	14	37079601	missense	possibly damaging	0.82
R0265:Cdhr1	UTSW	14	37081376	missense	probably benign	0.02
R0450:Cdhr1	UTSW	14	37080676	missense	probably damaging	0.99
R0510:Cdhr1	UTSW	14	37080676	missense	probably damaging	0.99
R0522:Cdhr1	UTSW	14	37094000	critical splice donor site	probably null
R0788:Cdhr1	UTSW	14	37087375	critical splice donor site	probably null
R0880:Cdhr1	UTSW	14	37080634	missense	possibly damaging	0.53
R1209:Cdhr1	UTSW	14	37082942	splice site	probably null
R1253:Cdhr1	UTSW	14	37079625	missense	probably benign
R1604:Cdhr1	UTSW	14	37095093	missense	probably benign	0.29
R1968:Cdhr1	UTSW	14	37079725	missense	probably benign	0.00
R2064:Cdhr1	UTSW	14	37095105	missense	probably benign	0.10
R2248:Cdhr1	UTSW	14	37081377	missense	probably benign
R3843:Cdhr1	UTSW	14	37084927	missense	probably benign	0.03
R4205:Cdhr1	UTSW	14	37080504	missense	probably benign	0.00
R4681:Cdhr1	UTSW	14	37096237	missense	probably benign	0.01
R5039:Cdhr1	UTSW	14	37079643	missense	probably benign	0.02
R5088:Cdhr1	UTSW	14	37089465	missense	probably benign	0.08
R5383:Cdhr1	UTSW	14	37089007	missense	possibly damaging	0.94
R5507:Cdhr1	UTSW	14	37082845	missense	probably damaging	0.98
R5933:Cdhr1	UTSW	14	37089462	missense	probably benign	0.01
R6074:Cdhr1	UTSW	14	37079643	missense	probably benign	0.02
R6291:Cdhr1	UTSW	14	37089465	missense	probably benign	0.31
R6449:Cdhr1	UTSW	14	37090597	missense	probably benign	0.35
R6890:Cdhr1	UTSW	14	37085645	missense	probably damaging	1.00
R6891:Cdhr1	UTSW	14	37097377	splice site	probably null
R7653:Cdhr1	UTSW	14	37082201	missense	probably benign	0.27
R7740:Cdhr1	UTSW	14	37089380	missense	probably damaging	0.98
R7805:Cdhr1	UTSW	14	37081545	missense	probably benign	0.00
R8081:Cdhr1	UTSW	14	37094010	missense	probably benign	0.01
R8147:Cdhr1	UTSW	14	37079652	missense	probably benign	0.02
R8164:Cdhr1	UTSW	14	37079542	missense	probably damaging	1.00
R8283:Cdhr1	UTSW	14	37082780	missense	probably benign	0.00
R8343:Cdhr1	UTSW	14	37091978	missense	probably benign	0.00
X0062:Cdhr1	UTSW	14	37079779	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCAACCTACTGTGACAG -3'
(R):5'- CATCAGGAACCAGAAGACTGTG -3'

Sequencing Primer
(F):5'- TACTGTGACAGCCACCACGTTG -3'
(R):5'- GTGGTATGAGCCTACAATCTCAGC -3'

Posted On

2015-06-10