Incidental Mutation 'R4178:Zfpm2'
ID 319607
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
MMRRC Submission 040864-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4178 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41103544 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 1010 (C1010R)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably damaging
Transcript: ENSMUST00000053467
AA Change: C1142R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: C1142R

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230319
AA Change: C1010R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl A G 14: 34,054,971 probably null Het
Atp2b2 A T 6: 113,793,718 V410E probably damaging Het
C6 G A 15: 4,735,139 V106I probably benign Het
Cdhr1 A C 14: 37,082,939 probably null Het
Cfap44 T A 16: 44,451,853 L1323Q possibly damaging Het
Ehd4 T A 2: 120,154,348 Y43F probably damaging Het
Eno1 T C 4: 150,244,033 I90T possibly damaging Het
Epb41l1 A G 2: 156,521,557 Y662C probably benign Het
Fkbp14 A G 6: 54,589,314 L103P probably damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Iqcd C A 5: 120,602,411 T269K probably damaging Het
Kat6b T A 14: 21,618,904 C249* probably null Het
Kcnab2 T C 4: 152,404,601 R109G probably null Het
Obox7 C A 7: 14,664,106 Q24K probably damaging Het
Obox7 A G 7: 14,664,107 Q24R probably damaging Het
Olfr1537 A C 9: 39,238,079 L115* probably null Het
Olfr491 A G 7: 108,317,358 N155D probably damaging Het
Olfr493 G A 7: 108,346,558 T141I probably benign Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Slf1 A G 13: 77,043,569 S1049P probably damaging Het
Smc1b A T 15: 85,120,647 F409I possibly damaging Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubr4 A G 4: 139,393,414 Y338C probably damaging Het
Usp6nl A G 2: 6,440,976 E588G probably benign Het
Vcan T C 13: 89,725,547 R63G probably damaging Het
Zfp775 A G 6: 48,613,253 probably null Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 41099316 missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 41103074 missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 41103471 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCAAATGAGAATGTCTCCCCAG -3'
(R):5'- ACCACAGCTATGAATACTGCTG -3'

Sequencing Primer
(F):5'- TGAGAATGTCTCCCCAGGAATTC -3'
(R):5'- TACACCTTAAGTCTTCAATTCAGCC -3'
Posted On 2015-06-10