Incidental Mutation 'R4178:Smc1b'
ID 319608
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Name structural maintenance of chromosomes 1B
Synonyms Smc1l2, SMC1beta
MMRRC Submission 040864-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.696) question?
Stock # R4178 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 84948890-85016158 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85004848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 409 (F409I)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068]
AlphaFold Q920F6
Predicted Effect possibly damaging
Transcript: ENSMUST00000023068
AA Change: F409I

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: F409I

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105085
SMART Domains Protein: ENSMUSP00000100709
Gene: ENSMUSG00000078289

DomainStartEndE-ValueType
Pfam:Ribosomal_L23eN 13 64 1.4e-26 PFAM
Pfam:Ribosomal_L23 72 139 4e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl A G 14: 33,776,928 (GRCm39) probably null Het
Atp2b2 A T 6: 113,770,679 (GRCm39) V410E probably damaging Het
C6 G A 15: 4,764,621 (GRCm39) V106I probably benign Het
Cdhr1 A C 14: 36,804,896 (GRCm39) probably null Het
Cfap44 T A 16: 44,272,216 (GRCm39) L1323Q possibly damaging Het
Ehd4 T A 2: 119,984,829 (GRCm39) Y43F probably damaging Het
Eno1 T C 4: 150,328,490 (GRCm39) I90T possibly damaging Het
Epb41l1 A G 2: 156,363,477 (GRCm39) Y662C probably benign Het
Fkbp14 A G 6: 54,566,299 (GRCm39) L103P probably damaging Het
Gm10322 C A 10: 59,452,052 (GRCm39) N56K probably benign Het
Iqcd C A 5: 120,740,476 (GRCm39) T269K probably damaging Het
Kat6b T A 14: 21,668,972 (GRCm39) C249* probably null Het
Kcnab2 T C 4: 152,489,058 (GRCm39) R109G probably null Het
Obox7 A G 7: 14,398,032 (GRCm39) Q24R probably damaging Het
Obox7 C A 7: 14,398,031 (GRCm39) Q24K probably damaging Het
Or5p1 A G 7: 107,916,565 (GRCm39) N155D probably damaging Het
Or5p68 G A 7: 107,945,765 (GRCm39) T141I probably benign Het
Or8g18 A C 9: 39,149,375 (GRCm39) L115* probably null Het
Rasgrf2 C T 13: 92,038,717 (GRCm39) G1043D probably damaging Het
Slf1 A G 13: 77,191,688 (GRCm39) S1049P probably damaging Het
Tab2 A G 10: 7,795,123 (GRCm39) V453A probably damaging Het
Ubr4 A G 4: 139,120,725 (GRCm39) Y338C probably damaging Het
Usp6nl A G 2: 6,445,787 (GRCm39) E588G probably benign Het
Vcan T C 13: 89,873,666 (GRCm39) R63G probably damaging Het
Zfp775 A G 6: 48,590,187 (GRCm39) probably null Het
Zfpm2 T C 15: 40,966,940 (GRCm39) C1010R probably damaging Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85,013,901 (GRCm39) missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85,016,099 (GRCm39) missense probably damaging 1.00
IGL01656:Smc1b APN 15 84,998,977 (GRCm39) missense probably damaging 0.99
IGL01807:Smc1b APN 15 84,980,946 (GRCm39) missense probably damaging 0.97
IGL02094:Smc1b APN 15 84,982,092 (GRCm39) splice site probably benign
IGL02121:Smc1b APN 15 84,982,186 (GRCm39) missense probably benign
IGL02631:Smc1b APN 15 84,991,204 (GRCm39) missense probably damaging 0.98
IGL02678:Smc1b APN 15 84,949,201 (GRCm39) nonsense probably null
IGL03197:Smc1b APN 15 84,955,064 (GRCm39) missense possibly damaging 0.85
IGL03214:Smc1b APN 15 84,982,147 (GRCm39) nonsense probably null
IGL03218:Smc1b APN 15 84,973,914 (GRCm39) missense probably benign 0.07
IGL03232:Smc1b APN 15 85,013,921 (GRCm39) missense possibly damaging 0.68
adamantine UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
unbreakable UTSW 15 84,980,859 (GRCm39) missense probably benign
E0370:Smc1b UTSW 15 85,011,782 (GRCm39) missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 84,953,852 (GRCm39) missense possibly damaging 0.91
R0092:Smc1b UTSW 15 84,951,925 (GRCm39) unclassified probably benign
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0207:Smc1b UTSW 15 85,007,960 (GRCm39) missense probably benign
R0390:Smc1b UTSW 15 84,950,478 (GRCm39) missense probably damaging 1.00
R0440:Smc1b UTSW 15 84,996,874 (GRCm39) splice site probably benign
R0685:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R1109:Smc1b UTSW 15 84,997,016 (GRCm39) missense probably damaging 0.98
R1392:Smc1b UTSW 15 84,991,271 (GRCm39) splice site probably benign
R1509:Smc1b UTSW 15 84,970,335 (GRCm39) missense probably benign
R1804:Smc1b UTSW 15 85,011,991 (GRCm39) missense possibly damaging 0.90
R1879:Smc1b UTSW 15 84,976,268 (GRCm39) missense probably benign 0.01
R2086:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2143:Smc1b UTSW 15 85,008,003 (GRCm39) missense probably benign
R2158:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2174:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2471:Smc1b UTSW 15 84,976,218 (GRCm39) missense probably damaging 0.98
R3689:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R3690:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R4420:Smc1b UTSW 15 84,997,031 (GRCm39) missense probably damaging 1.00
R4905:Smc1b UTSW 15 84,950,428 (GRCm39) missense probably damaging 1.00
R4919:Smc1b UTSW 15 85,001,305 (GRCm39) intron probably benign
R5114:Smc1b UTSW 15 84,949,185 (GRCm39) missense probably damaging 1.00
R5314:Smc1b UTSW 15 84,955,066 (GRCm39) missense probably benign 0.00
R5476:Smc1b UTSW 15 84,970,352 (GRCm39) missense probably damaging 0.97
R5593:Smc1b UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
R5690:Smc1b UTSW 15 84,996,974 (GRCm39) missense probably damaging 1.00
R5719:Smc1b UTSW 15 84,980,859 (GRCm39) missense probably benign
R5817:Smc1b UTSW 15 84,951,984 (GRCm39) missense probably damaging 0.99
R5834:Smc1b UTSW 15 84,973,866 (GRCm39) missense probably damaging 1.00
R5930:Smc1b UTSW 15 84,970,322 (GRCm39) missense probably damaging 1.00
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85,005,896 (GRCm39) missense probably damaging 1.00
R6306:Smc1b UTSW 15 85,011,824 (GRCm39) missense probably benign 0.30
R6392:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6426:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6435:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6436:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6437:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6508:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6512:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6703:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6737:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6775:Smc1b UTSW 15 84,973,881 (GRCm39) missense probably damaging 0.96
R6889:Smc1b UTSW 15 84,951,960 (GRCm39) missense probably damaging 1.00
R6908:Smc1b UTSW 15 84,991,211 (GRCm39) missense probably damaging 1.00
R7124:Smc1b UTSW 15 84,955,798 (GRCm39) missense probably damaging 0.98
R7400:Smc1b UTSW 15 84,953,921 (GRCm39) missense probably damaging 1.00
R7417:Smc1b UTSW 15 84,981,743 (GRCm39) missense probably benign 0.05
R7610:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R7873:Smc1b UTSW 15 84,994,851 (GRCm39) critical splice donor site probably null
R7890:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8004:Smc1b UTSW 15 84,981,815 (GRCm39) missense probably damaging 0.98
R8698:Smc1b UTSW 15 84,997,047 (GRCm39) missense probably benign 0.16
R8826:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8835:Smc1b UTSW 15 85,013,949 (GRCm39) missense possibly damaging 0.83
R8925:Smc1b UTSW 15 84,991,273 (GRCm39) splice site probably null
R9059:Smc1b UTSW 15 85,004,875 (GRCm39) nonsense probably null
R9149:Smc1b UTSW 15 84,950,431 (GRCm39) missense probably benign 0.00
R9241:Smc1b UTSW 15 84,976,209 (GRCm39) missense probably benign 0.00
R9245:Smc1b UTSW 15 85,004,846 (GRCm39) missense probably benign 0.03
R9301:Smc1b UTSW 15 85,011,995 (GRCm39) missense probably damaging 0.98
R9384:Smc1b UTSW 15 84,950,455 (GRCm39) missense probably damaging 0.99
R9750:Smc1b UTSW 15 85,016,106 (GRCm39) missense probably damaging 1.00
Z1176:Smc1b UTSW 15 85,016,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCCTACTCTAACTATAAAAGTGC -3'
(R):5'- AGATTTTGATGAGAACAGGATGCC -3'

Sequencing Primer
(F):5'- GGGATATCAGTGTTCTAAAACTAAGC -3'
(R):5'- TGAGAACAGGATGCCATATAATTTC -3'
Posted On 2015-06-10