Incidental Mutation 'R4179:Zranb3'
ID319614
Institutional Source Beutler Lab
Gene Symbol Zranb3
Ensembl Gene ENSMUSG00000036086
Gene Namezinc finger, RAN-binding domain containing 3
Synonyms4933425L19Rik
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location127954184-128103047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127960864 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 828 (I828N)
Ref Sequence ENSEMBL: ENSMUSP00000108157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086614] [ENSMUST00000112538]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086614
AA Change: I828N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083806
Gene: ENSMUSG00000036086
AA Change: I828N

DomainStartEndE-ValueType
DEXDc 33 214 3.37e-19 SMART
HELICc 352 435 3.79e-13 SMART
ZnF_RBZ 619 643 6.93e-5 SMART
HNHc 985 1036 5.64e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112538
AA Change: I828N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108157
Gene: ENSMUSG00000036086
AA Change: I828N

DomainStartEndE-ValueType
Pfam:SNF2_N 40 98 6.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186230
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Other mutations in Zranb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Zranb3 APN 1 128016140 missense probably benign 0.01
IGL00818:Zranb3 APN 1 128032867 missense probably damaging 1.00
IGL01360:Zranb3 APN 1 127959885 nonsense probably null
IGL01704:Zranb3 APN 1 127967939 missense possibly damaging 0.93
IGL02131:Zranb3 APN 1 127992951 missense probably damaging 1.00
IGL02466:Zranb3 APN 1 128016092 missense probably benign 0.08
IGL02825:Zranb3 APN 1 127959752 missense probably benign 0.13
IGL02836:Zranb3 APN 1 127960825 missense probably benign 0.00
R0088:Zranb3 UTSW 1 127976462 missense probably benign
R0279:Zranb3 UTSW 1 127963773 missense probably benign 0.01
R0423:Zranb3 UTSW 1 128091870 missense probably damaging 1.00
R0499:Zranb3 UTSW 1 127955080 splice site probably null
R0562:Zranb3 UTSW 1 128036558 missense probably benign 0.04
R0972:Zranb3 UTSW 1 127956646 missense probably damaging 1.00
R1480:Zranb3 UTSW 1 128091862 missense probably damaging 1.00
R1552:Zranb3 UTSW 1 127960751 splice site probably benign
R1704:Zranb3 UTSW 1 128092003 start codon destroyed probably null 0.22
R1817:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1818:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1819:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1951:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1953:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1988:Zranb3 UTSW 1 127959743 missense probably benign
R2011:Zranb3 UTSW 1 128091901 missense probably benign 0.00
R3159:Zranb3 UTSW 1 127972949 missense probably benign
R4281:Zranb3 UTSW 1 127963877 missense possibly damaging 0.69
R4400:Zranb3 UTSW 1 127956655 missense possibly damaging 0.87
R5236:Zranb3 UTSW 1 128040989 missense probably damaging 1.00
R5330:Zranb3 UTSW 1 127959720 missense probably damaging 0.99
R5719:Zranb3 UTSW 1 127963876 missense probably benign 0.00
R6125:Zranb3 UTSW 1 127959745 missense probably benign
R6220:Zranb3 UTSW 1 127999404 missense probably benign 0.44
R6414:Zranb3 UTSW 1 128040957 missense probably benign 0.08
R6751:Zranb3 UTSW 1 127959819 missense probably benign
R7229:Zranb3 UTSW 1 128040893 missense probably benign 0.00
R7419:Zranb3 UTSW 1 127963851 missense possibly damaging 0.86
R7537:Zranb3 UTSW 1 128032847 critical splice donor site probably null
R7771:Zranb3 UTSW 1 128032868 missense probably damaging 1.00
R7980:Zranb3 UTSW 1 128102934 unclassified probably benign
R8152:Zranb3 UTSW 1 127954995 missense probably damaging 1.00
R8370:Zranb3 UTSW 1 127967933 missense probably benign 0.00
R8458:Zranb3 UTSW 1 127992910 missense probably damaging 1.00
R8816:Zranb3 UTSW 1 128036610 missense possibly damaging 0.95
Z1176:Zranb3 UTSW 1 127965148 missense possibly damaging 0.55
Z1176:Zranb3 UTSW 1 128036481 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGGCAGTTATCACCGAAACTG -3'
(R):5'- AAGTGTCAGTTGTCCCTTCC -3'

Sequencing Primer
(F):5'- TCACCGAAACTGGTGTGTAC -3'
(R):5'- GGTCTCTCGTCTACACCCATG -3'
Posted On2015-06-10