Incidental Mutation 'R4179:Smox'
ID319617
Institutional Source Beutler Lab
Gene Symbol Smox
Ensembl Gene ENSMUSG00000027333
Gene Namespermine oxidase
SynonymsSMO, B130066H01Rik
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131491496-131525922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131524850 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 576 (M576I)
Ref Sequence ENSEMBL: ENSMUSP00000105815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028806] [ENSMUST00000110179] [ENSMUST00000110180] [ENSMUST00000110181] [ENSMUST00000110182] [ENSMUST00000110183] [ENSMUST00000110186] [ENSMUST00000110188] [ENSMUST00000110189] [ENSMUST00000129143] [ENSMUST00000183947] [ENSMUST00000183575]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028806
AA Change: M546I

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028806
Gene: ENSMUSG00000027333
AA Change: M546I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 7.2e-8 PFAM
Pfam:DAO 26 194 2.5e-9 PFAM
Pfam:NAD_binding_8 29 96 3.8e-18 PFAM
Pfam:Amino_oxidase 34 275 4.2e-27 PFAM
Pfam:Amino_oxidase 302 544 3.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110179
SMART Domains Protein: ENSMUSP00000105808
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 206 4.2e-10 PFAM
Pfam:Pyr_redox_3 28 101 2.3e-8 PFAM
Pfam:NAD_binding_8 29 96 1e-18 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110180
AA Change: M410I

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105809
Gene: ENSMUSG00000027333
AA Change: M410I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 5e-8 PFAM
Pfam:DAO 26 196 1.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.5e-18 PFAM
Pfam:Amino_oxidase 34 272 2.2e-27 PFAM
Pfam:Amino_oxidase 277 408 3.8e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110181
AA Change: M376I

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105810
Gene: ENSMUSG00000027333
AA Change: M376I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 3.6e-8 PFAM
Pfam:DAO 26 202 8.9e-10 PFAM
Pfam:NAD_binding_8 29 96 1.2e-18 PFAM
Pfam:Amino_oxidase 34 116 2.1e-22 PFAM
Pfam:Amino_oxidase 197 374 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110182
AA Change: M181I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105811
Gene: ENSMUSG00000027333
AA Change: M181I

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.2e-6 PFAM
Pfam:FAD_binding_2 26 87 1.6e-8 PFAM
Pfam:DAO 26 183 2.9e-9 PFAM
Pfam:Pyr_redox_3 28 103 1.4e-8 PFAM
Pfam:NAD_binding_8 29 96 6.3e-19 PFAM
Pfam:Amino_oxidase 34 118 3.6e-23 PFAM
Pfam:Amino_oxidase 129 179 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110183
AA Change: M239I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105812
Gene: ENSMUSG00000027333
AA Change: M239I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 227 5.1e-10 PFAM
Pfam:Pyr_redox_3 28 103 2.2e-8 PFAM
Pfam:NAD_binding_8 29 96 1.1e-18 PFAM
Pfam:Amino_oxidase 34 118 6.2e-23 PFAM
Pfam:Amino_oxidase 141 237 4.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110186
AA Change: M576I

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105815
Gene: ENSMUSG00000027333
AA Change: M576I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 78 1.7e-7 PFAM
Pfam:DAO 26 132 7.9e-9 PFAM
Pfam:NAD_binding_8 29 95 5.6e-18 PFAM
Pfam:Amino_oxidase 34 275 2.9e-28 PFAM
Pfam:Amino_oxidase 304 574 2.5e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110188
AA Change: V517I
SMART Domains Protein: ENSMUSP00000105817
Gene: ENSMUSG00000027333
AA Change: V517I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.9e-8 PFAM
Pfam:DAO 26 194 2.4e-9 PFAM
Pfam:NAD_binding_8 29 96 3.6e-18 PFAM
Pfam:Amino_oxidase 34 275 3.8e-27 PFAM
Pfam:Amino_oxidase 302 463 2.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110189
AA Change: V493I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105818
Gene: ENSMUSG00000027333
AA Change: V493I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.5e-8 PFAM
Pfam:DAO 26 194 2.2e-9 PFAM
Pfam:NAD_binding_8 29 96 3.4e-18 PFAM
Pfam:Amino_oxidase 34 275 3.5e-27 PFAM
Pfam:Amino_oxidase 302 462 5.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129143
SMART Domains Protein: ENSMUSP00000120237
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 9.3e-7 PFAM
Pfam:FAD_binding_2 26 86 8.9e-9 PFAM
Pfam:DAO 26 190 1.6e-10 PFAM
Pfam:Pyr_redox_3 28 102 9.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.7e-19 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151627
Predicted Effect probably benign
Transcript: ENSMUST00000183881
Predicted Effect probably benign
Transcript: ENSMUST00000183947
SMART Domains Protein: ENSMUSP00000139278
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.4e-6 PFAM
Pfam:FAD_binding_2 26 85 1.8e-8 PFAM
Pfam:DAO 26 200 5e-10 PFAM
Pfam:Pyr_redox_3 28 102 1.7e-8 PFAM
Pfam:NAD_binding_8 29 96 7.7e-19 PFAM
Pfam:Amino_oxidase 34 118 4.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183575
SMART Domains Protein: ENSMUSP00000139099
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:Thi4 17 73 8.6e-7 PFAM
Pfam:FAD_binding_2 26 75 3.3e-9 PFAM
Pfam:DAO 26 79 4.2e-10 PFAM
Pfam:Pyr_redox 26 79 1.4e-7 PFAM
Pfam:Pyr_redox_3 28 77 2.1e-9 PFAM
Pfam:NAD_binding_8 29 80 6.8e-15 PFAM
Pfam:Amino_oxidase 34 76 3.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Smox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Smox APN 2 131512059 missense possibly damaging 0.91
IGL02022:Smox APN 2 131520117 missense probably damaging 0.98
R0368:Smox UTSW 2 131522158 missense probably damaging 1.00
R0411:Smox UTSW 2 131520644 missense probably benign 0.02
R1416:Smox UTSW 2 131522131 missense probably damaging 1.00
R1601:Smox UTSW 2 131520174 missense probably damaging 1.00
R1959:Smox UTSW 2 131520464 missense probably damaging 0.97
R2173:Smox UTSW 2 131512024 missense possibly damaging 0.91
R2215:Smox UTSW 2 131520270 critical splice donor site probably null
R5282:Smox UTSW 2 131521106 missense probably damaging 0.99
R5630:Smox UTSW 2 131524866 nonsense probably null
R5979:Smox UTSW 2 131516414 missense probably damaging 0.99
R6984:Smox UTSW 2 131522111 missense possibly damaging 0.90
R6986:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7073:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7074:Smox UTSW 2 131522111 missense possibly damaging 0.90
R7183:Smox UTSW 2 131520566 missense possibly damaging 0.91
R8054:Smox UTSW 2 131522180 missense probably benign 0.01
X0026:Smox UTSW 2 131516235 missense probably damaging 1.00
Z1176:Smox UTSW 2 131520541 missense probably damaging 0.98
Z1177:Smox UTSW 2 131512086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTGCCTGGCAAGAGTG -3'
(R):5'- AAAGAAAAGCTCTCGGGCC -3'

Sequencing Primer
(F):5'- GCAAGAGTGGGGGTTCC -3'
(R):5'- AAAAGCTCTCGGGCCAGGTC -3'
Posted On2015-06-10