Incidental Mutation 'R4179:Crnn'
ID319620
Institutional Source Beutler Lab
Gene Symbol Crnn
Ensembl Gene ENSMUSG00000078657
Gene Namecornulin
SynonymsLOC381457
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93144787-93149819 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 93146813 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000141980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107300] [ENSMUST00000195515]
Predicted Effect probably null
Transcript: ENSMUST00000107300
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102921
Gene: ENSMUSG00000078657
AA Change: M1T

DomainStartEndE-ValueType
Pfam:S_100 4 45 1.9e-12 PFAM
Blast:EFh 53 81 1e-10 BLAST
low complexity region 181 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192372
Predicted Effect probably null
Transcript: ENSMUST00000195515
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141980
Gene: ENSMUSG00000078657
AA Change: M1T

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-10 PFAM
Blast:EFh 53 81 1e-10 BLAST
low complexity region 181 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the "fused gene" family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Crnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Crnn APN 3 93148212 missense probably damaging 1.00
IGL01343:Crnn APN 3 93148326 missense probably benign 0.01
IGL02393:Crnn APN 3 93149368 missense probably damaging 0.99
IGL03220:Crnn APN 3 93149367 missense possibly damaging 0.49
IGL03275:Crnn APN 3 93149418 missense possibly damaging 0.57
R1698:Crnn UTSW 3 93148458 missense probably damaging 0.97
R1745:Crnn UTSW 3 93146891 missense probably benign 0.33
R1761:Crnn UTSW 3 93148651 missense probably benign
R1974:Crnn UTSW 3 93149287 missense probably benign 0.01
R2109:Crnn UTSW 3 93148440 missense probably benign 0.43
R4976:Crnn UTSW 3 93148683 missense probably benign 0.12
R5120:Crnn UTSW 3 93148896 missense probably benign 0.03
R5425:Crnn UTSW 3 93149149 missense probably benign
R5695:Crnn UTSW 3 93149023 missense probably damaging 0.98
R6596:Crnn UTSW 3 93146875 missense probably damaging 1.00
R6981:Crnn UTSW 3 93148135 missense probably damaging 1.00
R7145:Crnn UTSW 3 93148382 missense probably damaging 1.00
R7170:Crnn UTSW 3 93148713 missense possibly damaging 0.85
R7365:Crnn UTSW 3 93148534 missense probably damaging 0.97
R7375:Crnn UTSW 3 93149145 missense possibly damaging 0.87
R7511:Crnn UTSW 3 93149416 missense probably damaging 1.00
R8669:Crnn UTSW 3 93148989 nonsense probably null
R8868:Crnn UTSW 3 93148302 missense probably benign 0.00
Z1177:Crnn UTSW 3 93149296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCAGAAACTTCCACAGTCTG -3'
(R):5'- TAAACACACGTTGGCTGTCC -3'

Sequencing Primer
(F):5'- GAAACTTCCACAGTCTGAGTGC -3'
(R):5'- AAACACACGTTGGCTGTCCTTATC -3'
Posted On2015-06-10