Mutagenetix > Incidental Mutation

Incidental Mutation 'R4179:Loxl3'

319624

Institutional Source

Beutler Lab

Gene Symbol

Loxl3

Ensembl Gene

ENSMUSG00000000693

Gene Name

lysyl oxidase-like 3

Synonyms

Lor2

MMRRC Submission

041015-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R4179 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83034173-83052562 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83037584 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 158 (V158I)

Ref Sequence

ENSEMBL: ENSMUSP00000098815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089651] [ENSMUST00000101257] [ENSMUST00000149918]

AlphaFold

Q9Z175

Predicted Effect

probably benign
Transcript: ENSMUST00000000707
AA Change: V158I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693
AA Change: V158I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
SR	45	146	2.1e-50	SMART
SR	170	283	1.09e-25	SMART
SR	308	408	3.72e-51	SMART
SR	418	526	8.5e-37	SMART
Pfam:Lysyl_oxidase	530	730	3.9e-103	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089651

SMART Domains

Protein: ENSMUSP00000087079
Gene: ENSMUSG00000068335

Domain	Start	End	E-Value	Type
PH	4	121	1.31e-8	SMART
IRS	151	254	1.21e-45	SMART
PTBI	152	254	3.84e-59	SMART
low complexity region	411	424	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101257
AA Change: V158I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693
AA Change: V158I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
SR	45	146	2.1e-50	SMART
SR	170	283	1.09e-25	SMART
SR	308	396	5.46e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204318

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	C	8: 43,651,091	M506V	probably benign	Het
Ano1	A	T	7: 144,650,505	M290K	probably damaging	Het
Arrdc2	A	T	8: 70,837,177	L34Q	probably damaging	Het
Cdadc1	G	T	14: 59,592,486	T77N	probably benign	Het
Cmtr2	C	G	8: 110,221,037		probably null	Het
Cnot2	A	T	10: 116,498,143	V374E	possibly damaging	Het
Crnn	T	C	3: 93,146,813	M1T	probably null	Het
Ctsb	A	G	14: 63,133,452	N38D	probably benign	Het
Dock10	A	C	1: 80,510,417	S2010A	probably benign	Het
Dqx1	A	G	6: 83,059,479	T155A	probably benign	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Eci1	T	C	17: 24,436,277	W119R	probably damaging	Het
Foxo1	C	A	3: 52,345,419	D334E	probably benign	Het
Gck	T	C	11: 5,910,295	T116A	probably benign	Het
Gcn1l1	T	C	5: 115,588,050	V588A	probably benign	Het
Gm7168	A	G	17: 13,949,003	I211V	probably benign	Het
Idh3g	A	T	X: 73,782,004		probably null	Het
Jag1	A	G	2: 137,101,658	F206S	probably damaging	Het
Ly6g	A	G	15: 75,155,718		probably null	Het
Myo1b	A	G	1: 51,778,526	F532L	probably damaging	Het
Naip1	T	A	13: 100,426,176	N827I	probably damaging	Het
Nlrp9c	G	A	7: 26,384,661	H498Y	possibly damaging	Het
Olfr149	A	G	9: 39,702,091	I226T	probably benign	Het
Pak2	C	G	16: 32,052,187	G59A	probably benign	Het
Pcdha2	T	A	18: 36,941,476	L720Q	probably damaging	Het
Pcdhb9	T	A	18: 37,401,115	M54K	probably benign	Het
Pde2a	A	G	7: 101,481,383	*71W	probably null	Het
Pkd2l1	T	C	19: 44,192,181	N32D	probably benign	Het
Pkhd1l1	A	C	15: 44,523,649	Y1306S	probably benign	Het
Plec	T	C	15: 76,180,215	K1953R	possibly damaging	Het
Plekhg4	T	A	8: 105,381,398	V1029E	possibly damaging	Het
Prkd1	C	A	12: 50,366,448	G647C	probably damaging	Het
Ptch1	C	T	13: 63,534,329	R537H	probably damaging	Het
Qser1	A	G	2: 104,776,384	I1510T	probably benign	Het
Ranbp3l	T	C	15: 9,057,198	I314T	possibly damaging	Het
Rgs9	C	A	11: 109,281,448		probably null	Het
Riok1	T	C	13: 38,048,955	F216L	probably damaging	Het
Rrm1	T	A	7: 102,457,198	I308N	probably damaging	Het
Serpina1f	A	T	12: 103,691,920	M242K	probably benign	Het
Smox	G	A	2: 131,524,850	M576I	possibly damaging	Het
Spaca7	A	T	8: 12,586,435	N87I	probably damaging	Het
Spink5	A	T	18: 43,987,867	Q296L	probably benign	Het
Sspo	T	C	6: 48,498,395		probably null	Het
Sult2b1	T	A	7: 45,735,311	I114F	probably damaging	Het
Tex12	T	C	9: 50,559,287		probably null	Het
Tonsl	A	G	15: 76,624,475	L26P	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Tsen54	T	C	11: 115,820,852	V365A	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Usp47	T	C	7: 112,087,884	L683P	probably damaging	Het
Wdr18	T	C	10: 79,965,041	L146P	probably damaging	Het
Zfp709	A	G	8: 71,889,906	Y392C	probably damaging	Het
Zranb3	A	T	1: 127,960,864	I828N	possibly damaging	Het

Other mutations in Loxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00957:Loxl3	APN	6	83048766	unclassified	probably benign
IGL01370:Loxl3	APN	6	83049487	missense	probably damaging	1.00
IGL02126:Loxl3	APN	6	83048647	missense	probably damaging	1.00
IGL02128:Loxl3	APN	6	83050583	missense	probably damaging	1.00
R0241:Loxl3	UTSW	6	83050133	missense	probably damaging	1.00
R0241:Loxl3	UTSW	6	83050133	missense	probably damaging	1.00
R1725:Loxl3	UTSW	6	83035593	missense	probably benign	0.00
R1771:Loxl3	UTSW	6	83049909	missense	probably damaging	1.00
R2017:Loxl3	UTSW	6	83048977	missense	probably damaging	0.99
R2291:Loxl3	UTSW	6	83037488	missense	probably benign	0.07
R3731:Loxl3	UTSW	6	83050671	critical splice donor site	probably null
R5230:Loxl3	UTSW	6	83035794	missense	probably benign	0.16
R5385:Loxl3	UTSW	6	83050612	missense	probably damaging	0.99
R5591:Loxl3	UTSW	6	83048037	missense	probably damaging	1.00
R5664:Loxl3	UTSW	6	83049882	missense	probably benign	0.12
R5769:Loxl3	UTSW	6	83050600	missense	probably damaging	0.98
R5771:Loxl3	UTSW	6	83035799	splice site	probably null
R5802:Loxl3	UTSW	6	83049289	missense	possibly damaging	0.67
R5831:Loxl3	UTSW	6	83049018	missense	probably benign	0.01
R5945:Loxl3	UTSW	6	83037511	missense	probably damaging	1.00
R6542:Loxl3	UTSW	6	83048166	missense	probably benign	0.00
R6687:Loxl3	UTSW	6	83050664	missense	probably damaging	1.00
R7961:Loxl3	UTSW	6	83050809	missense	possibly damaging	0.88
R8009:Loxl3	UTSW	6	83050809	missense	possibly damaging	0.88
R8122:Loxl3	UTSW	6	83049259	missense	probably damaging	1.00
R8278:Loxl3	UTSW	6	83048716	missense	probably damaging	1.00
R8373:Loxl3	UTSW	6	83048891	missense	possibly damaging	0.89
R8411:Loxl3	UTSW	6	83050624	missense	probably damaging	1.00
R8539:Loxl3	UTSW	6	83049526	missense	probably benign
R8684:Loxl3	UTSW	6	83035585	missense	probably benign	0.23
R8782:Loxl3	UTSW	6	83048070	missense	probably benign
R8801:Loxl3	UTSW	6	83048648	missense	probably damaging	1.00
R8859:Loxl3	UTSW	6	83037545	missense	probably damaging	1.00
R8864:Loxl3	UTSW	6	83035758	missense	probably damaging	0.99
R9031:Loxl3	UTSW	6	83035522	missense	probably damaging	1.00
R9081:Loxl3	UTSW	6	83048657	missense	possibly damaging	0.67
R9176:Loxl3	UTSW	6	83049311	missense	probably damaging	0.99
R9369:Loxl3	UTSW	6	83050412	missense	probably benign	0.26
R9634:Loxl3	UTSW	6	83050854	missense	probably benign	0.10
V1024:Loxl3	UTSW	6	83035738	missense	probably damaging	1.00
X0009:Loxl3	UTSW	6	83038480	missense	probably damaging	1.00
Z1177:Loxl3	UTSW	6	83038578	nonsense	probably null
Z1177:Loxl3	UTSW	6	83048160	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAGGCCACCATTACTGTCAG -3'
(R):5'- TTTCCAAGTGTCCCAGAAATCC -3'

Sequencing Primer
(F):5'- AGCCATCCTCAAACACTTCTTG -3'
(R):5'- GTGTCCCAGAAATCCACATTATC -3'

Posted On

2015-06-10